Construct: ORF TRCN0000479643
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015534.4_s317c1
- Derived from:
- ccsbBroadEn_15034
- DNA Barcode:
- AGAGGAATTTTACTATTGCCGGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HSPB8 (26353)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479643
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 26353 | HSPB8 | heat shock protein family B... | NM_014365.2 | 100% | 100% | |
| 2 | mouse | 80888 | Hspb8 | heat shock protein 8 | NM_030704.3 | 87.4% | 94.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 654
- ORF length:
- 588
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tgacggtcag atgcccttct cctgccacta cccaagccgc ctgcgccgag 121 accccttccg ggactctccc ctctcctctc gcctgctgga tgatggcttt ggcatggacc 181 ccttcccaga cgacttgaca gcctcttggc ccgactgggc tctgcctcgt ctctcctccg 241 cctggccagg caccctaagg tcgggcatgg tgccccgggg ccccactgcc accgccaggt 301 ttggggtgcc tgccgagggc aggacccccc cacccTTCCC TGGGGAGCCC TGGAAAGTGT 361 GTGTGAATGT GCACAGCTTC AAGCCAGAGG AGTTGATGGT GAAGACCAAA GATGGATACG 421 TGGAGGTGTC TGGCAAACAT GAAGAGAAAC AGCAAGAAGG TGGCATTGTT TCTAAGAACT 481 TCACAAAGAA AATCCAGCTT CCTGCAGAGG TGGATCCTGT GACAGTATTT GCCTCACTTT 541 CCCCAGAGGG TCTGCTGATC ATCGAAGCTC CCCAGGTCCC TCCTTACTCA ACATTTGGAG 601 AGAGCAGTTT CAACAACGAG CTTCCCCAGG ACAGCCAGGA AGTCACCTGT ACCTGCCCAA 661 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 721 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 781 TATCTTGTGG AAAGGACGAA GAGGAATTTT ACTATTGCCG GATACGCGTT AAGTCgacaa 841 tcaacctctg gattacaaaa tttgtgaaag att