Construct: ORF TRCN0000479667
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014375.1_s317c1
- Derived from:
- ccsbBroadEn_04130
- DNA Barcode:
- TCGCACTGGCCGATATATTAACCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VASH2 (79805)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479667
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79805 | VASH2 | vasohibin 2 | NM_024749.5 | 100% | 100% | |
| 2 | human | 79805 | VASH2 | vasohibin 2 | NM_001301056.2 | 87.6% | 87.3% | 366_497del |
| 3 | human | 79805 | VASH2 | vasohibin 2 | NM_001136474.3 | 69.2% | 69% | 0_1ins195;171_302del |
| 4 | human | 79805 | VASH2 | vasohibin 2 | NM_001136475.3 | 58.3% | 58% | 0_1ins312;54_185del |
| 5 | mouse | 226841 | Vash2 | vasohibin 2 | NM_144879.2 | 79.1% | 84.7% | (many diffs) |
| 6 | mouse | 226841 | Vash2 | vasohibin 2 | XM_006497149.4 | 71.1% | 76.2% | (many diffs) |
| 7 | mouse | 226841 | Vash2 | vasohibin 2 | XM_006497150.4 | 71.1% | 76.2% | (many diffs) |
| 8 | mouse | 226841 | Vash2 | vasohibin 2 | XM_011238913.3 | 71.1% | 76.2% | (many diffs) |
| 9 | mouse | 226841 | Vash2 | vasohibin 2 | NR_027352.1 | 21.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 999
- ORF length:
- 933
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac cggctccgcg gccgacactc accgctgccc ccaccccaaa ggcgccaaag 121 gcacccggtc ccggagcagc cacgcgcggc ccgtgagcct cgccaccagc gggggctcag 181 aggaggagga caaagacggc ggggtgctgt tccacgtcaa caagagcggc ttccccatcg 241 acagccacac ctgggagcgc atgtggatgc acgtggccaa ggtgcaccct aaggggggag 301 aaatggtggg cgccatcagg aacgccgcct tcttggcaaa gccttcaata ccccaggtcc 361 caaactacag gctgtcgatg acgatcccag actggctcca ggcgatccag aattacatga 421 agaccctaca ctacttaacc aatgggcagc cttccattga gcggttcccc atcagcttta 481 aaacctactt ctcaggaaac tactttcacc acgttgtgct ggggatttac tgcaatggcc 541 gctatggctc attgggcatg agccgcaggg ctgagctgat ggacaagcca ttgacttttc 601 ggactctgag tgacctcatc tttgactttg aggactctta caagaaatac ctgcacacag 661 tcaagaaggt caagattggg ctgtacgtcc cccatgagcc TCATAGCTTC CAGCCCATTG 721 AGTGGAAGCA GCTGGTCCTC AACGTCTCAA AGATGCTGAG GGCTGACATA AGGAAGGAGC 781 TGGAGAAATA TGCCAGGGAC ATGAGAATGA AGATCCTGAA ACCTGCAAGT GCCCACTCTC 841 CGACCCAAGT GAGAAGCCGG GGAAAATCCC TGTCCCCCAG AAGGAGACAG GCAAGCCCCC 901 CGAGGAGGCT CGGCCGGCGA GAGAAGTCGC CTGCACTGCC TGAAAAGAAG GTGGCTGATC 961 TGAGCACTCT GAATGAAGTG GGCTATCAAA TCCGAATTTA CCCAACTTTC TTGTACAAAG 1021 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1081 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1141 ACGATCGCAC TGGCCGATAT ATTAACCGAC GCGTTAAGTC gacaatcaac ctctggatta 1201 caaaatttgt gaaagatt