Construct: ORF TRCN0000479780
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013601.1_s317c1
- Derived from:
- ccsbBroadEn_13158
- DNA Barcode:
- AATCCTGACGCCTCGTCGTTCAGA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- M1AP (130951)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479780
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 130951 | M1AP | meiosis 1 associated protein | NM_001281295.2 | 100% | 100% | |
| 2 | human | 130951 | M1AP | meiosis 1 associated protein | XM_024452711.1 | 78.3% | 78.7% | (many diffs) |
| 3 | human | 130951 | M1AP | meiosis 1 associated protein | XM_011532553.2 | 71.8% | 72.1% | (many diffs) |
| 4 | human | 130951 | M1AP | meiosis 1 associated protein | NM_001281296.1 | 68.8% | 68.4% | (many diffs) |
| 5 | human | 130951 | M1AP | meiosis 1 associated protein | NM_001321739.2 | 68.3% | 67.9% | (many diffs) |
| 6 | human | 130951 | M1AP | meiosis 1 associated protein | NM_138804.4 | 68.3% | 67.9% | (many diffs) |
| 7 | human | 130951 | M1AP | meiosis 1 associated protein | XM_011532550.2 | 68.3% | 67.9% | (many diffs) |
| 8 | human | 130951 | M1AP | meiosis 1 associated protein | XM_011532551.2 | 68.3% | 67.9% | (many diffs) |
| 9 | human | 130951 | M1AP | meiosis 1 associated protein | XM_011532548.2 | 64.2% | 63.8% | (many diffs) |
| 10 | human | 130951 | M1AP | meiosis 1 associated protein | XM_006711946.3 | 63.7% | 63.3% | (many diffs) |
| 11 | human | 130951 | M1AP | meiosis 1 associated protein | XM_011532549.2 | 60.2% | 59.8% | (many diffs) |
| 12 | human | 130951 | M1AP | meiosis 1 associated protein | XM_011532552.2 | 53.5% | 52.9% | (many diffs) |
| 13 | human | 130951 | M1AP | meiosis 1 associated protein | XM_005264152.3 | 21.9% | 20.3% | (many diffs) |
| 14 | human | 130951 | M1AP | meiosis 1 associated protein | XM_011532554.2 | 21.8% | 20.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1161
- ORF length:
- 1095
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca tcctgggcga actactggta aagggccctc tactcacact cagattgacc 121 agcaacctcc acggcttctc attgtgcaca ttgctctacc gtcctgggct gacatctgca 181 ccaacctctg tgaggctctg cagaacttct tctctctagc ctgcagcttg atgggcccca 241 gccgcatgtc cctgttcagt ttatacatgg tacaagatca gcatgagtgc atcctccctt 301 ttgtgcaagt gaaagggaac tttgctaggt tgcagacctg catctcagaa ctccgcatgt 361 tacagagaga agggtgtttc agatcacaag gtgcttctct gcggctggca gtagaggatg 421 ggctccagca attcaaacaa tacagcagac atgtgaccac aagggcagct ctgacctata 481 cctccctgga gattactatt ctgacttctc agcctggaaa agaggtggtc aaacagttgg 541 aggaagggtt gaaagataca gacctagcca gagtcaggag gtttcaggtc gttgaggtca 601 caaagggaat cctagagcac gtggactcag cgtctcctgt tgaggatacc agcaatgatg 661 agagttctat tctgggaact gacattgacc ttcagactat agacaatgat atcgtcagca 721 tggagatttt cttcaaagcc tggctacata acagtggaac agaccaagaa caaatccatc 781 ttcttctttc ttcacagtgt ttcagcaaca tttccagacc cagagataat ccaatgtgtc 841 TGAAATGTGA TCTCCAAGAG CGACTGCTCT GCCCATCCCT ACTCGCTGGC ACAGCTGACG 901 GCTCCTTGAG AATGGATGAC CCTAAAGGAG ACTTCATCAC ACTCTACCAG ATGGCTTCCC 961 AGTCATCGGC CTCTCATTAC AAGCTCCAAG TGATCAAGGC TTTAAAATCT AGCGGGCTCT 1021 GCGAGTCATT GACATATGGA CTCCCGTTCA TCCTCAGACC TACAAGCTGT TGGCAGCTGG 1081 ACTGGGATGA GCTGGAGACA AATCAGCAAC ATTTCCATGC TTTGTGTCAC AGCCTGCTGG 1141 TGAGTACCCA TGTCCCCAGG TGACCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1201 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1261 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAAATC CTGACGCCTC 1321 GTCGTTCAGA ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt