Construct: ORF TRCN0000479900
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012035.1_s317c1
- Derived from:
- ccsbBroadEn_11882
- DNA Barcode:
- TTTAGATTCCCTCTGCACGCTGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IGLV4-3 (28786)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479900
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 100423062 | IGLL5 | immunoglobulin lambda like ... | NM_001256296.2 | 52.2% | 46.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 786
- ORF length:
- 720
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ctgggtctcc ttctacctac tgcccttcat tttctccaca ggtctctgtg 121 ctctgcctgt gctgactcag cccccgtctg catctgcctt cctgggagcc tcgatcaagc 181 tcacctgcac cctaagcaga gagcacagct cctacaccat cgaatggtat caacagagac 241 cagggaggtc cccccagtat ataatgaagg ttaagagtga tggcagccac aacaaggggg 301 acgggatccc cgatcgcttc atgggctcca gttctggggc tgaccgctac ctcaccttgt 361 ccaacctcca gtctgacgat gaggctgaat atcactgtgg agagagccac acgattgatg 421 gccaagtcgg ttgggtgttc ggcggaggga ccaagctgac cgtccTAAGT CAGCCCAAGG 481 CTGCCCCCTC GGTCACTCTG TTCCCGCCCT CCTCTGAGGA GCTTCAAGCC AACAAGGCCA 541 CACTGGTGTG TCTCATAAGT GACTTCTACC CGGGAGCCGT GACAGTGGCC TGGAAGGCAG 601 ATAGCAGCCC CGTCAAGGCG GGAGTGGAGA CCACCACACC CTCCAAACAA AGCAACAACA 661 AGTACGCGGC CAGCAGCTAC CTGAGCCTGA CGCCTGAGCA GTGGAAGTCC CACAGAAGCT 721 ACAGCTGCCA GGTCACGCAT GAAGGGAGCA CCGTGGAGAA GACAGTGGCC CCTATAGAAT 781 GTTCATACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 841 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 901 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATTTAGATTC CCTCTGCACG CTGCCACGCG 961 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt