Construct: ORF TRCN0000480043
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009580.2_s317c1
- Derived from:
- ccsbBroadEn_02595
- DNA Barcode:
- TGGTCCACGTGGATTTGAGCTGGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KDELR2 (11014)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480043
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 11014 | KDELR2 | KDEL endoplasmic reticulum ... | NM_001100603.2 | 100% | 100% | |
| 2 | human | 11014 | KDELR2 | KDEL endoplasmic reticulum ... | NM_006854.4 | 70.3% | 49.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 624
- ORF length:
- 558
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa cattttccgg ctgactgggg acctgtccca cctggcggcc atcgtcatcc 121 tgctgctgaa gatctggaag acgcgctcct gcgccggtat ttctgggaaa agccagcttc 181 tgtttgcact ggtcttcaca actcgttacc tggatctttt tacttcattt atttcattgt 241 ataacacatc tatgaaggtt atctaccttg cctgctccta tgccacagtg tacctgatct 301 acctgaaatt taaggcaacc TACGATGGAA ATCATGATAC CTTCCGAGTG GAGTTTCTGG 361 TGGTCCCTGT GGGAGGCCTC TCATTTTTAG TTAATCACGA TTTCTCTCCT CTTGAGTACT 421 CAAGGGAAAG AAGCTCAGTT TGCCAGCATA AGTGCCAAAG ACCATCACCA GCATCTGTCC 481 TTCAGGGTGC TCGGACAGAA TTCTTACCAC AGCAAAGGCA TAAGATGCTT GATACGGAAA 541 ATCAGAAACT TAACTCTTTT GTTGCAGATA GTCATCAGTG GCTCTGTAAA AACGCAGAGG 601 AAAAGAGCCA GAAGGTTTCT GTTTACCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 661 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 721 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAT GGTCCACGTG 781 GATTTGAGCT GGGACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 841 att