Construct: ORF TRCN0000480197
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003205.3_s317c1
- Derived from:
- ccsbBroadEn_15220
- DNA Barcode:
- ACACGAGGAATACCCCCTTCCCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TP53RK (112858)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480197
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 112858 | TP53RK | TP53 regulating kinase | NM_033550.4 | 100% | 100% |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 825
- ORF length:
- 759
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggcggccaga gctactacgc cggccgatgg cgaggagccc gccccggagg 121 ctgaggctct ggccgcagcc cgggagcgga gcagccgctt cttgagcggc ctggagctgg 181 tgaagcaggg tgccgaggcg cgcgtgttcc gtggccgctt ccagggccgc gcggcggtga 241 tcaagcaccg cttccccaag ggctaccggc acccggcgct ggaggcgcgg cttggcagac 301 ggcggacggt gcaggaggcc cgggcgctcc tccgctgtcg ccgcgctgga atatctgccc 361 cagttgtctt ttttgtggac tatgcttcca actgcttata tatggaagaa attgaaggct 421 cagtgactgt tcgagattat attcagtcca ctatggagac tgaaaaaact ccccagggtc 481 tctccaacTT AGCCAAGACA ATTGGGCAGG TTTTGGCTCG AATGCACGAT GAAGACCTCA 541 TTCATGGTGA TCTCACCACC TCCAACATGC TCCTGAAACC CCCCCTGGAA CAGCTGAACA 601 TTGTGCTCAT AGACTTTGGG CTGAGTTTCA TTTCAGCACT TCCAGAGGAT AAGGGAGTAG 661 ACCTCTATGT CCTGGAGAAG GCCTTCCTCA GTACCCATCC CAACACTGAA ACTGTGTTTG 721 AAGCCTTTCT GAAGAGCTAC TCCACCTCCT CCAAAAAGGC CAGGCCAGTG CTAAAAAAAT 781 TAGATGAAGT GCGCCTGAGA GGAAGAAAGA GGTCCATGGT TGGGTACCCA ACTTTCTTGT 841 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 901 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 961 GAAAGGACGA ACACGAGGAA TACCCCCTTC CCCCACGCGT TAAGTCgaca atcaacctct 1021 ggattacaaa atttgtgaaa gatt