Construct: ORF TRCN0000480352
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009365.3_s317c1
- Derived from:
- ccsbBroadEn_14904
- DNA Barcode:
- CAGAAACAGGGCACACTCATCTTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PDXK (8566)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480352
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8566 | PDXK | pyridoxal kinase | NM_003681.5 | 100% | 100% | |
| 2 | human | 8566 | PDXK | pyridoxal kinase | XM_005261196.3 | 90.8% | 86.4% | (many diffs) |
| 3 | human | 8566 | PDXK | pyridoxal kinase | NM_001331030.2 | 86.9% | 85.2% | (many diffs) |
| 4 | human | 8566 | PDXK | pyridoxal kinase | XM_011529758.3 | 81.7% | 73.7% | (many diffs) |
| 5 | human | 8566 | PDXK | pyridoxal kinase | XM_005261199.2 | 76.6% | 76.6% | 0_1ins219 |
| 6 | human | 8566 | PDXK | pyridoxal kinase | XM_011529760.2 | 76.6% | 76.6% | 0_1ins219 |
| 7 | human | 8566 | PDXK | pyridoxal kinase | XM_011529761.1 | 76.6% | 76.6% | 0_1ins219 |
| 8 | human | 8566 | PDXK | pyridoxal kinase | XM_017028483.2 | 76.6% | 76.6% | 0_1ins219 |
| 9 | human | 8566 | PDXK | pyridoxal kinase | XM_017028484.1 | 76.6% | 76.6% | 0_1ins219 |
| 10 | human | 8566 | PDXK | pyridoxal kinase | XM_005261195.2 | 74.8% | 70.7% | (many diffs) |
| 11 | mouse | 216134 | Pdxk | pyridoxal (pyridoxine, vita... | NM_172134.2 | 84.8% | 86.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1002
- ORF length:
- 936
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ggaggagtgc cgggtgctct ccatacagag ccacgtcatc cgcggctacg 121 tgggcaaccg ggcggccacg ttcccgctgc aggttttggg atttgagatt gacgcggtga 181 actctgtcca gttttcaaac cacacaggct atgcccactg gaagggccaa gtgctgaatt 241 cagatgagct ccaggagttg tacgaaggcc tgaggctgaa caacatgaat aaatatgact 301 acgtgctcac aggttatacg agggacaagt cgttcctggc catggtggtg gacattgtgc 361 aggagctgaa gcagcagaac cccaggctgg tgtacgtgtg tgatccagtc ttgggtgaca 421 agtgggacgg cgaaggctcg atgtacgtcc cggaggacct ccttcccgtc tacaaagaaa 481 aagtggtgcc gcttgcagac attatcacgc ccaaccagtt tgaggccgag ttactgagtg 541 gccggaagat ccacagccag gaggaagcct tgcgggtgat ggacatgctg cactctatgg 601 gccccgacac cgtggtcatc accagcTCCG ACCTGCCCTC CCCGCAGGGC AGCAACTACC 661 TGATTGTGCT GGGGAGTCAG AGGAGGAGGA ATCCCGCTGG CTCCGTGGTG ATGGAACGCA 721 TCCGGATGGA CATTCGCAAA GTGGACGCCG TCTTTGTGGG CACTGGGGAC CTGTTTGCTG 781 CCATGCTCCT GGCGTGGACA CACAAGCACC CCAATAACCT CAAGGTGGCC TGTGAGAAGA 841 CCGTGTCTAC CTTGCACCAC GTTCTGCAGA GGACCATCCA GTGTGCAAAA GCCCAGGCCG 901 GGGAAGGAGT GAGGCCCAGC CCCATGCAGC TGGAGCTGCG GATGGTGCAG AGCAAAAGGG 961 ACATCGAGGA CCCAGAGATC GTCGTCCAGG CCACGGTGCT GTGCCCAACT TTCTTGTACA 1021 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1081 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1141 AGGACGACAG AAACAGGGCA CACTCATCTT GACGCGTTAA GTCgacaatc aacctctgga 1201 ttacaaaatt tgtgaaagat t