Construct: ORF TRCN0000480710
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003420.1_s317c1
- Derived from:
- ccsbBroadEn_14006
- DNA Barcode:
- CATCCCAGATGTGCAGCACTATTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CCN4 (8840)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480710
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8840 | CCN4 | cellular communication netw... | NM_003882.4 | 99.7% | 99.4% | 5_7delGGTinsNNN |
| 2 | human | 8840 | CCN4 | cellular communication netw... | XM_024447319.1 | 78.7% | 70.3% | 0_1ins211;115_116ins23 |
| 3 | human | 8840 | CCN4 | cellular communication netw... | NM_080838.3 | 76% | 75.4% | 5_7delGGTinsNNN;349_350ins261 |
| 4 | human | 8840 | CCN4 | cellular communication netw... | XM_024447320.1 | 55% | 45.4% | 0_1ins211;114_115ins284 |
| 5 | human | 8840 | CCN4 | cellular communication netw... | XM_024447321.1 | 48% | 46% | (many diffs) |
| 6 | human | 8840 | CCN4 | cellular communication netw... | NM_001204869.2 | 41.9% | 34.6% | 5_7delGGTinsNNN;349_350ins455;465_466ins181 |
| 7 | human | 8840 | CCN4 | cellular communication netw... | NM_001204870.2 | 30.3% | 28.3% | (many diffs) |
| 8 | human | 8840 | CCN4 | cellular communication netw... | NR_037944.2 | 12.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1170
- ORF length:
- 1101
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gannnggttc ctgccctgga cgctggcagc agtgacagca gcagccgcca 121 gcaccgtcct ggccacggcc ctctctccag cccctacgac catggacttt accccagctc 181 cactggagga cacctcctca cgcccccaat tctgcaagtg gccatgtgag tgcccgccat 241 ccccaccccg ctgcccgctg ggggtcagcc tcatcacaga tggctgtgag tgctgtaaga 301 tgtgcgctca gcagcttggg gacaactgca cggaggctgc catctgtgac ccccaccggg 361 gcctctactg tgactacagc ggggaccgcc cgaggtacgc aataggagtg tgtgcacagg 421 tggtcggtgt gggctgcgtc ctggatgggg tgcgctacaa caacggccag tccttccagc 481 ctaactgcaa gtacaactgc acgtgcatcg acggcgcggt gggctgcaca ccactgtgcc 541 tccgagtgcg ccccccgcgt ctctggtgcc cccacccgcg gcgcgtgagc atacctggcc 601 actgctgtga gcagtgggta tgtgaggacg acgccaagag gccacgcaag accgcacccc 661 gtgacacagg agccttcgat gctgtgggtg aggtggaggc atggcacagg aactgcatag 721 cctacacaag cccctggagc ccttgctcca ccagctgcgg cctgggggtc tccactcgga 781 tctccaatgt taacgcccag tgctggcctg agcaagagag ccgccTCTGC AACTTGCGGC 841 CATGCGATGT GGACATCCAT ACACTCATTA AGGCAGGGAA GAAGTGTCTG GCTGTGTACC 901 AGCCAGAGGC ATCCATGAAC TTCACACTTG CGGGCTGCAT CAGCACACGC TCCTATCAAC 961 CCAAGTACTG TGGAGTTTGC ATGGACAATA GGTGCTGCAT CCCCTACAAG TCTAAGACTA 1021 TCGACGTGTC CTTCCAGTGT CCTGATGGGC TTGGCTTCTC CCGCCAGGTC CTATGGATTA 1081 ATGCCTGCTT CTGTAACCTG AGCTGTAGGA ATCCCAATGA CATCTTTGCT GACTTGGAAT 1141 CCTACCCTGA CTTCTCAGAA ATTGCCAACT TGCCAACTTT CTTGTACAAA GTGGTTGATA 1201 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1261 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGACATCC 1321 CAGATGTGCA GCACTATTGA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1381 tgaaagatt