Construct: ORF TRCN0000487683
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020455.1_s317c1
- DNA Barcode:
- AGGTGTCTTGTGCACGATTTGGCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- DDR1 (780)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487683
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 780 | DDR1 | discoidin domain receptor t... | NM_001297654.1 | 99.8% | 100% | 282G>C;525C>T;1908T>C |
| 2 | human | 780 | DDR1 | discoidin domain receptor t... | NM_013993.2 | 99.8% | 100% | 282G>C;525C>T;1908T>C |
| 3 | human | 780 | DDR1 | discoidin domain receptor t... | NM_013994.2 | 99.2% | 99.3% | (many diffs) |
| 4 | human | 780 | DDR1 | discoidin domain receptor t... | XM_011514883.2 | 99.2% | 99.3% | (many diffs) |
| 5 | human | 780 | DDR1 | discoidin domain receptor t... | XM_011514884.1 | 99.2% | 99.3% | (many diffs) |
| 6 | human | 780 | DDR1 | discoidin domain receptor t... | XM_011514885.2 | 99.2% | 99.3% | (many diffs) |
| 7 | human | 780 | DDR1 | discoidin domain receptor t... | XM_011514886.2 | 99.2% | 99.3% | (many diffs) |
| 8 | human | 780 | DDR1 | discoidin domain receptor t... | XM_011514887.2 | 99.2% | 99.3% | (many diffs) |
| 9 | human | 780 | DDR1 | discoidin domain receptor t... | XM_017011268.2 | 99.2% | 99.3% | (many diffs) |
| 10 | human | 780 | DDR1 | discoidin domain receptor t... | XM_024446540.1 | 99.2% | 99.3% | (many diffs) |
| 11 | human | 780 | DDR1 | discoidin domain receptor t... | XM_024446541.1 | 99.2% | 99.3% | (many diffs) |
| 12 | human | 780 | DDR1 | discoidin domain receptor t... | XM_024446542.1 | 99.2% | 99.3% | (many diffs) |
| 13 | human | 780 | DDR1 | discoidin domain receptor t... | XM_006715185.2 | 97.9% | 98% | (many diffs) |
| 14 | human | 780 | DDR1 | discoidin domain receptor t... | XM_011514882.2 | 97.3% | 97.4% | (many diffs) |
| 15 | human | 780 | DDR1 | discoidin domain receptor t... | NM_001297652.1 | 95.8% | 95.9% | (many diffs) |
| 16 | human | 780 | DDR1 | discoidin domain receptor t... | NM_001297653.1 | 95.8% | 95.9% | (many diffs) |
| 17 | human | 780 | DDR1 | discoidin domain receptor t... | NM_001954.4 | 95.8% | 95.9% | (many diffs) |
| 18 | human | 780 | DDR1 | discoidin domain receptor t... | XM_017011269.2 | 95.2% | 95.3% | (many diffs) |
| 19 | human | 780 | DDR1 | discoidin domain receptor t... | NM_001202523.1 | 93.9% | 94% | (many diffs) |
| 20 | human | 780 | DDR1 | discoidin domain receptor t... | XM_011514888.3 | 93.3% | 93.4% | (many diffs) |
| 21 | human | 780 | DDR1 | discoidin domain receptor t... | NM_001202522.1 | 83.8% | 82.3% | (many diffs) |
| 22 | human | 780 | DDR1 | discoidin domain receptor t... | NM_001202521.1 | 55.3% | 55.2% | (many diffs) |
| 23 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | NM_001198831.1 | 87.6% | 93.4% | (many diffs) |
| 24 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | NM_001198833.1 | 87.6% | 93.4% | (many diffs) |
| 25 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | NM_007584.2 | 87.6% | 93.4% | (many diffs) |
| 26 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | XM_006523533.1 | 87.6% | 93.4% | (many diffs) |
| 27 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | XM_006523534.1 | 87.6% | 93.4% | (many diffs) |
| 28 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | XM_006523535.3 | 87.6% | 93.4% | (many diffs) |
| 29 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | XM_006523536.3 | 87.6% | 93.4% | (many diffs) |
| 30 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | XM_006523537.1 | 87.6% | 93.4% | (many diffs) |
| 31 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | XM_011246259.1 | 87.6% | 93.4% | (many diffs) |
| 32 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | NM_172962.1 | 83.6% | 89.3% | (many diffs) |
| 33 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | XM_006523538.3 | 83.6% | 89.3% | (many diffs) |
| 34 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | XR_001782030.1 | 61.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 2811
- ORF length:
- 2739
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgggacca gaggccctgt catctttact gctgctgctc ttggtggcaa 121 gtggagatgc tgacatgaag ggacattttg atcctgccaa gtgccgctat gccctgggca 181 tgcaggaccg gaccatccca gacagtgaca tctctgcttc cagctcctgg tcagattcca 241 ctgccgcccg ccacagcagg ttggagagca gtgacgggga tggggcctgg tgccccgcag 301 ggtcggtgtt tcccaaggag gaggagtact tgcaggtgga tctacaacga ctccacctgg 361 tggctctggt gggcacccag ggacggcatg ccgggggcct gggcaaggag ttctcccgga 421 gctaccggct gcgttactcc cgggatggtc gccgctggat gggctggaag gaccgctggg 481 gtcaggaggt gatctcaggc aatgaggacc ctgagggagt ggtgctgaag gaccttgggc 541 cccccatggt tgcccgactg gttcgcttct acccccgggc tgaccgggtc atgagtgtct 601 gtctgcgggt agagctctat ggctgcctct ggagggatgg actcctgtct tacaccgccc 661 ctgtggggca gacaatgtat ttatctgagg ccgtgtacct caacgactcc acctatgacg 721 gacataccgt gggcggactg cagtatgggg gtctgggcca gctggcagat ggtgtggtgg 781 ggctggatga ctttaggaag agtcaggagc tgcgggtctg gccaggctat gactatgtgg 841 gatggagcaa ccacagcttc tccagtggct atgtggagat ggagtttgag tttgaccggc 901 tgagggcctt ccaggctatg caggtccact gtaacaacat gcacacgctg ggagcccgtc 961 tgcctggcgg ggtggaatgt cgcttccggc gtggccctgc catggcctgg gagggggagc 1021 ccatgcgcca caacctaggg ggcaacctgg gggaccccag agcccgggct gtctcagtgc 1081 cccttggcgg ccgtgtggct cgctttctgc agtgccgctt cctctttgcg gggccctggt 1141 tactcttcag cgaaatctcc ttcatctctg atgtggtgaa caattcctct ccggcactgg 1201 gaggcacctt cccgccagcc ccctggtggc cgcctggccc acctcccacc aacttcagca 1261 gcttggagct ggagcccaga ggccagcagc ccgtggccaa ggccgagggg agcccgaccg 1321 ccatcctcat cggctgcctg gtggccatca tcctgctcct gctgctcatc attgccctca 1381 tgctctggcg gctgcactgg cgcaggctcc tcagcaaggc tgaacggagg gtgttggaag 1441 aggagctgac ggttcacctc tctgtccctg gggacactat cctcatcaac aaccgcccag 1501 gtcctagaga gccacccccg taccaggagc cccggcctcg tgggaatccg ccccactccg 1561 ctccctgtgt ccccaatggc tctgcgttgc tgctctccaa tccagcctac cgcctccttc 1621 tggccactta cgcccgtccc cctcgaggcc cgggcccccc cacacccgcc tgggccaaac 1681 ccaccaacac ccaggcctac agtggggact atatggagcc tgagaagcca ggcgccccgc 1741 ttctgccccc acctccccag aacagcgtcc cccattatgc cgaggctgac attgttaccc 1801 tgcagggcgt caccgggggc aacacctatg ctgtgcctgc actgccccca ggggcagtcg 1861 gggatgggcc ccccagagtg gatttccctc gatctcgact ccgcttcaag gagaagcttg 1921 gcgagggcca gtttggggag gtgcacctgt gtgaggtcga cagccctcaa gatctggtca 1981 gtcttgattt cccccttaat gtgcgtaagg gacacccttt gctggtagct gtcaagatct 2041 tacggccaga tgccaccaag aatgccagga atgatttcct gaaagaggtg aagatcatgt 2101 cgaggctcaa ggacccaaac atcattcggc tgctgggcgt gtgtgtgcag gacgaccccc 2161 tctgcatgat tactgactac atggagaacg gcgacctcaa ccagttcctc agtgcccacc 2221 agctggagga caaggcagcc gagggggccc ctggggacgg gcaggctgcg caggggccca 2281 ccatcagcta cccaatgctg ctgcatgtgg cagcccagat cgcctccggc atgcgctatc 2341 tggccacact caactttgta catcgggacc tggccacgcg gaactgccta gttggggaaa 2401 atttcaccat caaaatcgca gactttggca tgagccggaa cctctatgct ggggactatt 2461 accgtgtgca gggccgggca gtgctgccca tccgctggat ggcctgggag tgcatcctca 2521 tggggaagtt cacgactgcg agtgacgtgt gggcctttgg tgtgaccctg tgggaggtgc 2581 tgatgctctg tagggcccag ccctttgggc agctCACCGA CGAGCAGGTC ATCGAGAACG 2641 CGGGGGAGTT CTTCCGGGAC CAGGGCCGGC AGGTGTACCT GTCCCGGCCG CCTGCCTGCC 2701 CGCAGGGCCT ATATGAGCTG ATGCTTCGGT GCTGGAGCCG GGAGTCTGAG CAGCGACCAC 2761 CCTTTTCCCA GCTGCATCGG TTCCTGGCAG AGGATGCACT CAACACGGTG TAGGACCCAG 2821 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 2881 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 2941 TATCTTGTGG AAAGGACGAA GGTGTCTTGT GCACGATTTG GCCACGCGTT AAGTCgacaa 3001 tcaacctctg gattacaaaa tttgtgaaag att