Construct: ORF TRCN0000487800
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020627.1_s317c1
- DNA Barcode:
- TCGCACGTTTTACAGTTATTCCCT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- SRMS (6725)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487800
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6725 | SRMS | src-related kinase lacking ... | NM_080823.3 | 99.7% | 100% | 588C>T;900C>A;1419C>T |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1536
- ORF length:
- 1464
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggagccg ttcctcagga ggcggctggc cttcctgtcc ttcttctggg 121 acaagatctg gccggcgggc ggcgagccgg accatggcac ccccgggtcc ctggacccca 181 acactgaccc agtgcccacg ctccccgccg agccttgcag ccccttccct cagctcttcc 241 ttgcgctcta tgacttcacg gcgcggtgtg gcggggagct gagtgtccgc cgcggggaca 301 ggctctgtgc cctcgaagag gggggcggct acatcttcgc acgcaggctt tcgggccagc 361 ccagcgccgg gctcgtgccc atcacccacg tggccaaggc ttctcctgag acgctctcag 421 accaaccctg gtactttagc ggggtcagtc ggacccaggc acagcagctg ctcctctccc 481 cacccaacga accaggggcc ttcctcatcc ggcccagcga gagcagcctc gggggctact 541 cactgtcagt ccgggcccag gccaaggtct gccactaccg ggtctccatg gcagctgatg 601 gcagcctcta cctgcagaag ggacggctct ttcccggcct ggaggagctg ctcacctatt 661 acaaggccaa ctggaagctg atccagaacc ccctgctgca gccctgcatg ccccagaagg 721 ccccgaggca ggacgtgtgg gagcggccac actccgaatt cgcccttggg aggaagctgg 781 gtgaaggcta ctttggggag gtgtgggaag gcctgtggct gggctccctg cccgtggcga 841 tcaaggtcat caagtcagcc aacatgaagc tcactgacct cgccaaggag atccagacac 901 tgaagggcct gcggcacgag cggctcatcc ggctgcacgc agtgtgctcg ggcggggagc 961 ctgtgtacat agtcacggaa ctcatgcgca aggggaacct gcaggccttc ctgggcaccc 1021 ccgagggccg ggccctgcgt ctgccgccac tcctgggctt tgcctgccag gtggctgagg 1081 gcatgagcta cctggaggag cagcgcgttg tgcaccggga cttggccgcc cggaacgtgc 1141 tcgtggacga cggcctggcc tgcaaggtgg ctgacttcgg cctggcccgg ctgctcaagg 1201 acgacatcta ctccccgagc agcagctcca agatcccggt caagtggaca gcgcctgagg 1261 cggccaatta tcgtgtcttc tcccagaagt cagacgtctg gtccTTCGGC GTCCTGCTGC 1321 ACGAGGTTTT CACCTATGGC CAGTGTCCCT ATGAAGGGAT GACCAACCAC GAGACGCTGC 1381 AGCAGATCAT GCGAGGGTAC CGGCTGCCGC GCCCGGCTGC CTGCCCGGCG GAGGTCTACG 1441 TGCTCATGCT GGAGTGCTGG AGGAGCAGCC CCGAGGAACG GCCCTCCTTT GCCACGCTGC 1501 GGGAGAAGCT GCACGCCATC CACAGATGCC ACCCCTGAGA CCCAGCTTTC TTGTACAAAG 1561 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1621 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1681 ACGATCGCAC GTTTTACAGT TATTCCCTAC GCGTTAAGTC gacaatcaac ctctggatta 1741 caaaatttgt gaaagatt