Construct: ORF TRCN0000487952
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019736.1_s317c1
- DNA Barcode:
- CCTCATCTTACATACTAGGTTGCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TNFRSF9 (3604)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487952
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3604 | TNFRSF9 | TNF receptor superfamily me... | NM_001561.6 | 99.8% | 99.6% | 765_766insG |
| 2 | human | 3604 | TNFRSF9 | TNF receptor superfamily me... | XM_006710618.3 | 89.9% | 89% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 840
- ORF length:
- 768
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgggaaac agctgttaca acatagtagc cactctgttg ctggtcctca 121 actttgagag gacaagatca ttgcaggatc cttgtagtaa ctgcccagct ggtacattct 181 gtgataataa caggaatcag atttgcagtc cctgtcctcc aaatagtttc tccagcgcag 241 gtggacaaag gacctgtgac atatgcaggc agtgtaaagg tgttttcagg accaggaagg 301 agtgttcctc caccagcaat gcagagtgtg actgcactcc agggtttcac tgcctggggg 361 caggatgcag catgtgtgaa caggattgta aacaaggtca agaactgaca aaaaaaggtt 421 gtaaagactg ttgctttggg acatttaacg atcagaaacg tggcatctgt cgaccctgga 481 caaactgttc tttggatgga aagtctgtgc ttgtgaatgg gacgaaggag agggacgtgg 541 tctgtggacc atctccagcc gacctctctc cgggagcaTC CTCTGTGACC CCGCCTGCCC 601 CTGCGAGAGA GCCAGGACAC TCTCCGCAGA TCATCTCCTT CTTTCTTGCG CTGACGTCGA 661 CTGCGTTGCT CTTCCTGCTG TTCTTCCTCA CGCTCCGTTT CTCTGTTGTT AAACGGGGCA 721 GAAAGAAACT CCTGTATATA TTCAAACAAC CATTTATGAG ACCAGTACAA ACTACTCAAG 781 AGGAAGATGG CTGTAGCTGC CGATTTCCAG AAGAAGAAGA AGGAGGATGT GAACTGGACC 841 CAGCTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 901 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 961 ATATATCTTG TGGAAAGGAC GACCTCATCT TACATACTAG GTTGCTACGC GTTAAGTCga 1021 caatcaacct ctggattaca aaatttgtga aagatt