Construct: ORF TRCN0000488376
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020229.1_s317c1
- DNA Barcode:
- TTCCCGACATTAGTATCGTGTCTG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- TP53RK (112858)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488376
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 112858 | TP53RK | TP53 regulating kinase | NM_033550.4 | 100% | 100% |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 831
- ORF length:
- 759
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggcggcg gccagagcta ctacgccggc cgatggcgag gagcccgccc 121 cggaggctga ggctctggcc gcagcccggg agcggagcag ccgcttcttg agcggcctgg 181 agctggtgaa gcagggtgcc gaggcgcgcg tgttccgtgg ccgcttccag ggccgcgcgg 241 cggtgatcaa gcaccgcttc cccaagggct accggcaccc ggcgctggag gcgcggcttg 301 gcagacggcg gacggtgcag gaggcccggg cgctcctccg ctgtcgccgc gctggaatat 361 ctgccccagt tgtctttttt gtggactatg cttccaactg cttatatatg gaagaaattg 421 aaggctcagt gactgttcga gattatattc agtccactat ggagactgaa aaaactcccc 481 agggtctctc caacttagcc aagacaattg ggcaggtttt ggctcgaatg cacgatgaag 541 acctcattca tggtgatctc acCACCTCCA ACATGCTCCT GAAACCCCCC CTGGAACAGC 601 TGAACATTGT GCTCATAGAC TTTGGGCTGA GTTTCATTTC AGCACTTCCA GAGGATAAGG 661 GAGTAGACCT CTATGTCCTG GAGAAGGCCT TCCTCAGTAC CCATCCCAAC ACTGAAACTG 721 TGTTTGAAGC CTTTCTGAAG AGCTACTCCA CCTCCTCCAA AAAGGCCAGG CCAGTGCTAA 781 AAAAATTAGA TGAAGTGCGC CTGAGAGGAA GAAAGAGGTC CATGGTTGGG TGAGACCCAG 841 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 901 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 961 TATCTTGTGG AAAGGACGAT TCCCGACATT AGTATCGTGT CTGACGCGTT AAGTCgacaa 1021 tcaacctctg gattacaaaa tttgtgaaag att