Construct: ORF TRCN0000488405
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020841.1_s317c1
- DNA Barcode:
- TCAAAGCGCCCACGGTAATGGACC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GPR35 (2859)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488405
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2859 | GPR35 | G protein-coupled receptor 35 | NM_005301.3 | 100% | 100% | |
| 2 | human | 2859 | GPR35 | G protein-coupled receptor 35 | NM_001195381.2 | 90.8% | 90.8% | 1_93del |
| 3 | human | 2859 | GPR35 | G protein-coupled receptor 35 | NM_001195382.2 | 90.8% | 90.8% | 1_93del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 999
- ORF length:
- 927
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgaatggc acctacaaca cctgtggctc cagcgacctc acctggcccc 121 cagcgatcaa gctgggcttc tacgcctact tgggcgtcct gctggtgcta ggcctgctgc 181 tcaacagcct ggcgctctgg gtgttctgct gccgcatgca gcagtggacg gagacccgca 241 tctacatgac caacctggcg gtggccgacc tctgcctgct gtgcaccttg cccttcgtgc 301 tgcactccct gcgagacacc tcagacacgc cgctgtgcca gctctcccag ggcatctacc 361 tgaccaacag gtacatgagc atcagcctgg tcacggccat cgccgtggac cgctatgtgg 421 ccgtgcggca cccgctgcgt gcccgcgggc tgcggtcccc caggcaggct gcggccgtgt 481 gcgcggtcct ctgggtgctg gtcatcggct ccctggtggc tcgctggctc ctggggattc 541 aggagggcgg cttctgcttc aggagcaccc ggcacaattt caactccatg gcgttcccgc 601 tgctgggatt ctacctgccc ctggccgtgg tggtcttctg ctccctgaag gtggtgactg 661 ccctggccca gaggccaccc accgacgtgg GGCAGGCAGA GGCCACCCGC AAGGCTGCCC 721 GCATGGTCTG GGCCAACCTC CTGGTGTTCG TGGTCTGCTT CCTGCCCCTG CACGTGGGGC 781 TGACAGTGCG CCTCGCAGTG GGCTGGAACG CCTGTGCCCT CCTGGAGACG ATCCGTCGCG 841 CCCTGTACAT AACCAGCAAG CTCTCAGATG CCAACTGCTG CCTGGACGCC ATCTGCTACT 901 ACTACATGGC CAAGGAGTTC CAGGAGGCGT CTGCACTGGC CGTGGCTCCC AGTGCTAAGG 961 CCCACAAAAG CCAGGACTCT CTGTGCGTGA CCCTCGCCTA GGACCCAGCT TTCTTGTACA 1021 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1081 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1141 AGGACGATCA AAGCGCCCAC GGTAATGGAC CACGCGTTAA GTCgacaatc aacctctgga 1201 ttacaaaatt tgtgaaagat t