Construct: ORF TRCN0000488413
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020205.1_s317c1
- DNA Barcode:
- TACGTTTATATTTTAAATCTTGAT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- CKB (1152)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488413
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1152 | CKB | creatine kinase B | NM_001823.5 | 99.8% | 100% | 456C>A;1092G>A |
| 2 | human | 1152 | CKB | creatine kinase B | NM_001362531.2 | 93.9% | 94% | 346_417del;528C>A;1164G>A |
| 3 | human | 1152 | CKB | creatine kinase B | XM_017020952.1 | 56.8% | 56.9% | 456C>A;651_652ins492 |
| 4 | mouse | 12709 | Ckb | creatine kinase, brain | NM_021273.4 | 90.4% | 96.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1215
- ORF length:
- 1143
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgcccttc tccaacagcc acaacgcact gaagctgcgc ttcccggccg 121 aggacgagtt ccccgacctg agcgcccaca acaaccacat ggccaaggtg ctgacccccg 181 agctgtacgc ggagctgcgc gccaagagca cgccgagcgg cttcacgctg gacgacgtca 241 tccagacagg cgtggacaac ccgggccacc cgtacatcat gaccgtgggc tgcgtggcgg 301 gcgacgagga gtcctacgaa gtgttcaagg atctcttcga ccccatcatc gaggaccggc 361 acggcggcta caagcccagc gatgagcaca agaccgacct caaccccgac aacctgcagg 421 gcggcgacga cctggacccc aactacgtgc tgagctcgcg ggtgcgcacg ggccgcagca 481 tccgtggctt ctgcctcccc ccgcactgca gccgcgggga gcgccgagcc atcgagaagc 541 tcgcggtgga agccctgtcc agcctggacg gcgacctggc gggccgatac tacgcgctca 601 agagcatgac ggaggcggag cagcagcagc tcatcgacga ccacttcctc ttcgacaagc 661 ccgtgtcgcc cctgctgctg gcctcgggca tggcccgcga ctggcccgac gcccgcggta 721 tctggcacaa tgacaataag accttcctgg tgtgggtcaa cgaggaggac cacctgcggg 781 tcatctccat gcagaagggg ggcaacatga aggaggtgtt cacccgcttc tgcaccggcc 841 tcacccagat tgaaactctc ttcaagtcta aggactatga gttcatgtgg aaccctcacc 901 TGGGCTACAT CCTCACCTGC CCATCCAACC TGGGCACCGG GCTGCGGGCA GGTGTGCATA 961 TCAAGCTGCC CAACCTGGGC AAGCATGAGA AGTTCTCGGA GGTGCTTAAG CGGCTGCGAC 1021 TTCAGAAGCG AGGCACAGGC GGTGTGGACA CGGCTGCGGT GGGCGGGGTC TTCGACGTCT 1081 CCAACGCTGA CCGCCTGGGC TTCTCAGAGG TGGAGCTGGT GCAGATGGTG GTGGACGGAG 1141 TGAAGCTGCT CATCGAGATG GAACAGCGGC TGGAGCAGGG CCAGGCCATC GACGACCTCA 1201 TGCCTGCCCA GAAATGAGAC CCAGCTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1261 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1321 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGATACGTTT ATATTTTAAA 1381 TCTTGATACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt