Construct: ORF TRCN0000488722
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020223.1_s317c1
- DNA Barcode:
- TGATGCAACTCCCATTCACCCTGT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- MAPK3 (5595)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488722
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5595 | MAPK3 | mitogen-activated protein k... | NM_002746.3 | 100% | 100% | |
| 2 | human | 5595 | MAPK3 | mitogen-activated protein k... | NM_001040056.3 | 92.8% | 88.1% | (many diffs) |
| 3 | human | 5595 | MAPK3 | mitogen-activated protein k... | NM_001109891.1 | 88.3% | 88.3% | 774_775ins132 |
| 4 | human | 5595 | MAPK3 | mitogen-activated protein k... | XR_243293.1 | 59% | 1_100del;1238_1927del | |
| 5 | mouse | 26417 | Mapk3 | mitogen-activated protein k... | NM_011952.2 | 90% | 96.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1209
- ORF length:
- 1137
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggcggcg gcggcggctc aggggggcgg gggcggggag ccccgtagaa 121 ccgagggggt cggcccgggg gtcccggggg aggtggagat ggtgaagggg cagccgttcg 181 acgtgggccc gcgctacacg cagttgcagt acatcggcga gggcgcgtac ggcatggtca 241 gctcggccta tgaccacgtg cgcaagactc gcgtggccat caagaagatc agccccttcg 301 aacatcagac ctactgccag cgcacgctcc gggagatcca gatcctgctg cgcttccgcc 361 atgagaatgt catcggcatc cgagacattc tgcgggcgtc caccctggaa gccatgagag 421 atgtctacat tgtgcaggac ctgatggaga ctgacctgta caagttgctg aaaagccagc 481 agctgagcaa tgaccatatc tgctacttcc tctaccagat cctgcggggc ctcaagtaca 541 tccactccgc caacgtgctc caccgagatc taaagccctc caacctgctc atcaacacca 601 cctgcgacct taagatttgt gatttcggcc tggcccggat tgccgatcct gagcatgacc 661 acaccggctt cctgacggag tatgtggcta cgcgctggta ccgggcccca gagatcatgc 721 tgaactccaa gggctatacc aagtccatcg acatctggtc tgtgggctgc attctggctg 781 agatgctctc taaccggccc atcttccctg gcaagcacta cctggatcag ctcaaccaca 841 ttctgggcat cctgggctcc ccatcccagg aggacctgaa ttgtatcatc aacatgaagg 901 cccgaaacta ccTACAGTCT CTGCCCTCCA AGACCAAGGT GGCTTGGGCC AAGCTTTTCC 961 CCAAGTCAGA CTCCAAAGCC CTTGACCTGC TGGACCGGAT GTTAACCTTT AACCCCAATA 1021 AACGGATCAC AGTGGAGGAA GCGCTGGCTC ACCCCTACCT GGAGCAGTAC TATGACCCGA 1081 CGGATGAGCC AGTGGCCGAG GAGCCCTTCA CCTTCGCCAT GGAGCTGGAT GACCTACCTA 1141 AGGAGCGGCT GAAGGAGCTC ATCTTCCAGG AGACAGCACG CTTCCAGCCC GGAGTGCTGG 1201 AGGCCCCCTG AGACCCAGCT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1261 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1321 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGATGA TGCAACTCCC ATTCACCCTG 1381 TACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t