Construct: ORF TRCN0000488767
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021635.1_s317c1
- DNA Barcode:
- TCCAACCTGAGAATCATAAATAGA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- NR1H2 (7376)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488767
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7376 | NR1H2 | nuclear receptor subfamily ... | NM_007121.7 | 99.7% | 99.7% | 514_515insAAC |
| 2 | human | 7376 | NR1H2 | nuclear receptor subfamily ... | NM_001256647.2 | 78.7% | 78.5% | 181_182ins291;223_224insAAC |
| 3 | mouse | 22260 | Nr1h2 | nuclear receptor subfamily ... | NM_001285517.1 | 83.2% | 87.4% | (many diffs) |
| 4 | mouse | 22260 | Nr1h2 | nuclear receptor subfamily ... | NM_009473.3 | 83.2% | 87.4% | (many diffs) |
| 5 | mouse | 22260 | Nr1h2 | nuclear receptor subfamily ... | XM_006540804.3 | 83.2% | 87.4% | (many diffs) |
| 6 | mouse | 22260 | Nr1h2 | nuclear receptor subfamily ... | NM_001285518.1 | 82.7% | 87.2% | (many diffs) |
| 7 | mouse | 22260 | Nr1h2 | nuclear receptor subfamily ... | NM_001285519.1 | 82.7% | 87.2% | (many diffs) |
| 8 | mouse | 22260 | Nr1h2 | nuclear receptor subfamily ... | XM_017322126.1 | 71.5% | 76.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1455
- ORF length:
- 1383
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgtcctct cctaccacga gttccctgga tacccccctg cctggaaatg 121 gcccccctca gcctggcgcc ccttcttctt cacccactgt aaaggaggag ggtccggagc 181 cgtggcccgg gggtccggac cctgatgtcc caggcactga tgaggccagc tcagcctgca 241 gcacagactg ggtcatccca gatcccgaag aggaaccaga gcgcaagcga aagaagggcc 301 cagccccgaa gatgctgggc cacgagcttt gccgtgtctg tggggacaag gcctccggct 361 tccactacaa cgtgctcagc tgcgaaggct gcaagggctt cttccggcgc agtgtggtcc 421 gtggtggggc caggcgctat gcctgccggg gtggcggaac ctgccagatg gacgctttca 481 tgcggcgcaa gtgccagcag tgccggctgc gcaagtgcaa ggaggcaggg atgagggagc 541 agtgcgtcct ttctgaagaa cagatccgga agaagaagat tcggaaacaa cagcagcagg 601 agtcacagtc acagtcgcag tcacctgtgg ggccgcaggg cagcagcagc tcagcctctg 661 ggcctggggc ttcccctggt ggatctgagg caggcagcca gggctccggg gaaggcgagg 721 gtgtccagct aacagcggct caagaactaa tgatccagca gttggtggcg gcccaactgc 781 agtgcaacaa acgctccttc tccgaccagc ccaaagtcac gccctggccc ctgggcgcag 841 acccccagtc ccgagatgcc cgccagcaac gctttgccca cttcacggag ctggccatca 901 tctcagtcca ggagatcgtg gacttcgcta agcaagtgcc tggtttcctg cagctgggcc 961 gggaggacca gatcgccctc ctgaaggcat ccactatcga gatcatgctg ctagagacag 1021 ccaggcgcta caaccacgag acagagtgta tcaccttctt gaaggacttc acctacagca 1081 aggacgactt ccaccgtgca ggccTGCAGG TGGAGTTCAT CAACCCCATC TTCGAGTTCT 1141 CGCGGGCCAT GCGGCGGCTG GGCCTGGACG ACGCTGAGTA CGCCCTGCTC ATCGCCATCA 1201 ACATCTTCTC GGCCGACCGG CCCAACGTGC AGGAGCCGGG CCGCGTGGAG GCGTTGCAGC 1261 AGCCCTACGT GGAGGCGCTG CTGTCCTACA CGCGCATCAA GAGGCCGCAG GACCAGCTGC 1321 GCTTCCCGCG CATGCTCATG AAGCTGGTGA GCCTGCGCAC GCTGAGCTCT GTGCACTCGG 1381 AGCAGGTCTT CGCCTTGCGG CTCCAGGACA AGAAGCTGCC GCCTCTGCTG TCGGAGATCT 1441 GGGACGTCCA CGAGTGAGAC CCAGCTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1501 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1561 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGATCCAACC TGAGAATCAT 1621 AAATAGAACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt