Construct: ORF TRCN0000488804
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020377.1_s317c1
- DNA Barcode:
- TCTCAGTACGATGCGAAGAAAGCA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PDXK (8566)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488804
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8566 | PDXK | pyridoxal kinase | NM_003681.5 | 100% | 100% | |
| 2 | human | 8566 | PDXK | pyridoxal kinase | XM_005261196.3 | 90.8% | 86.4% | (many diffs) |
| 3 | human | 8566 | PDXK | pyridoxal kinase | NM_001331030.2 | 86.9% | 85.2% | (many diffs) |
| 4 | human | 8566 | PDXK | pyridoxal kinase | XM_011529758.3 | 81.7% | 73.7% | (many diffs) |
| 5 | human | 8566 | PDXK | pyridoxal kinase | XM_005261199.2 | 76.6% | 76.6% | 0_1ins219 |
| 6 | human | 8566 | PDXK | pyridoxal kinase | XM_011529760.2 | 76.6% | 76.6% | 0_1ins219 |
| 7 | human | 8566 | PDXK | pyridoxal kinase | XM_011529761.1 | 76.6% | 76.6% | 0_1ins219 |
| 8 | human | 8566 | PDXK | pyridoxal kinase | XM_017028483.2 | 76.6% | 76.6% | 0_1ins219 |
| 9 | human | 8566 | PDXK | pyridoxal kinase | XM_017028484.1 | 76.6% | 76.6% | 0_1ins219 |
| 10 | human | 8566 | PDXK | pyridoxal kinase | XM_005261195.2 | 74.8% | 70.7% | (many diffs) |
| 11 | mouse | 216134 | Pdxk | pyridoxal (pyridoxine, vita... | NM_172134.2 | 84.8% | 86.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1008
- ORF length:
- 936
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggaggag gagtgccggg tgctctccat acagagccac gtcatccgcg 121 gctacgtggg caaccgggcg gccacgttcc cgctgcaggt tttgggattt gagattgacg 181 cggtgaactc tgtccagttt tcaaaccaca caggctatgc ccactggaag ggccaagtgc 241 tgaattcaga tgagctccag gagttgtacg aaggcctgag gctgaacaac atgaataaat 301 atgactacgt gctcacaggt tatacgaggg acaagtcgtt cctggccatg gtggtggaca 361 ttgtgcagga gctgaagcag cagaacccca ggctggtgta cgtgtgtgat ccagtcttgg 421 gtgacaagtg ggacggcgaa ggctcgatgt acgtcccgga ggacctcctt cccgtctaca 481 aagaaaaagt ggtgccgctt gcagacatta tcacgcccaa ccagtttgag gccgagttac 541 tgagtggccg gaagatccac agccaggagg aagccttgcg ggtgatggac atgctgcact 601 ctatgggccc cgacaccgtg gtcatcacca gctccgacct gccctccccg cagggcagca 661 actaccTGAT TGTGCTGGGG AGTCAGAGGA GGAGGAATCC CGCTGGCTCC GTGGTGATGG 721 AACGCATCCG GATGGACATT CGCAAAGTGG ACGCCGTCTT TGTGGGCACT GGGGACCTGT 781 TTGCTGCCAT GCTCCTGGCG TGGACACACA AGCACCCCAA TAACCTCAAG GTGGCCTGTG 841 AGAAGACCGT GTCTACCTTG CACCACGTTC TGCAGAGGAC CATCCAGTGT GCAAAAGCCC 901 AGGCCGGGGA AGGAGTGAGG CCCAGCCCCA TGCAGCTGGA GCTGCGGATG GTGCAGAGCA 961 AAAGGGACAT CGAGGACCCA GAGATCGTCG TCCAGGCCAC GGTGCTGTAG GACCCAGCTT 1021 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1081 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1141 CTTGTGGAAA GGACGATCTC AGTACGATGC GAAGAAAGCA ACGCGTTAAG TCgacaatca 1201 acctctggat tacaaaattt gtgaaagatt