Construct: ORF TRCN0000488839
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020514.1_s317c1
- DNA Barcode:
- TACTTAGTCCCGTAACAGCTCATC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PDXK (8566)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488839
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8566 | PDXK | pyridoxal kinase | NM_003681.5 | 91% | 91% | 247_330del |
| 2 | human | 8566 | PDXK | pyridoxal kinase | XM_005261196.3 | 82.3% | 78% | (many diffs) |
| 3 | human | 8566 | PDXK | pyridoxal kinase | XM_005261199.2 | 79.1% | 67.6% | (many diffs) |
| 4 | human | 8566 | PDXK | pyridoxal kinase | XM_011529760.2 | 79.1% | 67.6% | (many diffs) |
| 5 | human | 8566 | PDXK | pyridoxal kinase | XM_011529761.1 | 79.1% | 67.6% | (many diffs) |
| 6 | human | 8566 | PDXK | pyridoxal kinase | XM_017028483.2 | 79.1% | 67.6% | (many diffs) |
| 7 | human | 8566 | PDXK | pyridoxal kinase | XM_017028484.1 | 79.1% | 67.6% | (many diffs) |
| 8 | human | 8566 | PDXK | pyridoxal kinase | NM_001331030.2 | 77.9% | 76.2% | (many diffs) |
| 9 | human | 8566 | PDXK | pyridoxal kinase | XM_011529758.3 | 74.2% | 66.4% | (many diffs) |
| 10 | human | 8566 | PDXK | pyridoxal kinase | XM_005261195.2 | 68% | 63.9% | (many diffs) |
| 11 | mouse | 216134 | Pdxk | pyridoxal (pyridoxine, vita... | NM_172134.2 | 77% | 77.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 924
- ORF length:
- 852
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggaggag gagtgccggg tgctctccat acagagccac gtcatccgcg 121 gctacgtggg caaccgggcg gccacgttcc cgctgcaggt tttgggattt gagattgacg 181 cggtgaactc tgtccagttt tcaaaccaca caggctatgc ccactggaag ggccaagtgc 241 tgaattcaga tgagctccag gagttgtacg aaggcctgag gctgaacaac atgaataaat 301 atgactacgt gctcacagtg tgtgatccag tcttgggtga caagtgggac ggcgaaggct 361 cgatgtacgt cccggaggac ctccttcccg tctacaaaga aaaagtggtg ccgcttgcag 421 acattatcac gcccaaccag tttgaggccg agttactgag tggccggaag atccacagcc 481 aggaggaagc cttgcgggtg atggacatgc tgcactctat gggccccgac accgtggtca 541 tcaccagctc cgacctgccc tccccgcagg gcagcaacta cctgattgtg ctggGGAGTC 601 AGAGGAGGAG GAATCCCGCT GGCTCCGTGG TGATGGAACG CATCCGGATG GACATTCGCA 661 AAGTGGACGC CGTCTTTGTG GGCACTGGGG ACCTGTTTGC TGCCATGCTC CTGGCGTGGA 721 CACACAAGCA CCCCAATAAC CTCAAGGTGG CCTGTGAGAA GACCGTGTCT ACCTTGCACC 781 ACGTTCTGCA GAGGACCATC CAGTGTGCAA AAGCCCAGGC CGGGGAAGGA GTGAGGCCCA 841 GCCCCATGCA GCTGGAGCTG CGGATGGTGC AGAGCAAAAG GGACATCGAG GACCCAGAGA 901 TCGTCGTCCA GGCCACGGTG CTGTAGAACC CAGCTTTCTT GTACAAAGTG GTTGATATCG 961 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1021 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATACTTAGT 1081 CCCGTAACAG CTCATCACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1141 aagatt