Construct: ORF TRCN0000489190
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020207.1_s317c1
- DNA Barcode:
- CGGTGCACAGCGCGGCGCTTAGCG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- CDK5 (1020)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489190
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1020 | CDK5 | cyclin dependent kinase 5 | NM_004935.4 | 100% | 100% | |
| 2 | human | 1020 | CDK5 | cyclin dependent kinase 5 | NM_001164410.3 | 89% | 89% | 311_312ins96 |
| 3 | mouse | 12568 | Cdk5 | cyclin-dependent kinase 5 | NM_007668.3 | 90.8% | 99.6% | (many diffs) |
| 4 | mouse | 12568 | Cdk5 | cyclin-dependent kinase 5 | XM_006535626.2 | 83.4% | 90.4% | (many diffs) |
| 5 | mouse | 12568 | Cdk5 | cyclin-dependent kinase 5 | XR_389739.3 | 33% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 948
- ORF length:
- 876
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgcagaaa tacgagaaac tggaaaagat tggggaaggc acctacggaa 121 ctgtgttcaa ggccaaaaac cgggagactc atgagatcgt ggctctgaaa cgggtgaggc 181 tggatgacga tgatgagggt gtgccgagtt ccgccctccg ggagatctgc ctactcaagg 241 agctgaagca caagaacatc gtcaggcttc atgacgtcct gcacagcgac aagaagctga 301 ctttggtttt tgaattctgt gaccaggacc tgaagaagta ttttgacagt tgcaatggtg 361 acctcgatcc tgagattgta aagtcattcc tcttccagct actaaaaggg ctgggattct 421 gtcatagccg caatgtgcta cacagggacc tgaagcccca gaacctgcta ataaacagga 481 atggggagct gaaattggct gattttggcc tggctcgagc ctttgggatt cccgtccgct 541 gttactcagc tgaggtggtc acactgtggt accgcccacc ggatgTCCTC TTTGGGGCCA 601 AGCTGTACTC CACGTCCATC GACATGTGGT CAGCCGGCTG CATCTTTGCA GAGCTGGCCA 661 ATGCTGGGCG GCCTCTTTTT CCCGGCAATG ATGTCGATGA CCAGTTGAAG AGGATCTTCC 721 GACTGCTGGG GACGCCCACC GAGGAGCAGT GGCCCTCTAT GACCAAGCTG CCAGACTATA 781 AGCCCTATCC GATGTACCCG GCCACAACAT CCCTGGTGAA CGTCGTGCCC AAACTCAATG 841 CCACAGGGAG GGATCTGCTG CAGAACCTTC TGAAGTGTAA CCCTGTCCAG CGTATCTCAG 901 CAGAAGAGGC CCTGCAGCAC CCCTACTTCT CCGACTTCTG TCCGCCCTGA GACCCAGCTT 961 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1021 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1081 CTTGTGGAAA GGACGACGGT GCACAGCGCG GCGCTTAGCG ACGCGTTAAG TCgacaatca 1141 acctctggat tacaaaattt gtgaaagatt