Construct: ORF TRCN0000489396
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020587.1_s317c1
- DNA Barcode:
- ACGCACACCTCCTACACTTAAGCT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PINK1 (65018)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489396
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 65018 | PINK1 | PTEN induced kinase 1 | NM_032409.3 | 100% | 100% | |
| 2 | human | 102464833 | MIR6084 | microRNA 6084 | NR_106732.1 | 6.3% | 0_1ins130;110_111ins1503 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1815
- ORF length:
- 1743
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggcggtg cgacaggcgc tgggccgcgg cctgcagctg ggtcgagcgc 121 tgctgctgcg cttcacgggc aagcccggcc gggcctacgg cttggggcgg ccgggcccgg 181 cggcgggctg tgtccgcggg gagcgtccag gctgggccgc aggaccgggc gcggagcctc 241 gcagggtcgg gctcgggctc cctaaccgtc tccgcttctt ccgccagtcg gtggccgggc 301 tggcggcgcg gttgcagcgg cagttcgtgg tgcgggcctg gggctgcgcg ggcccttgcg 361 gccgggcagt ctttctggcc ttcgggctag ggctgggcct catcgaggaa aaacaggcgg 421 agagccggcg ggcggtctcg gcctgtcagg agatccaggc aatttttacc cagaaaagca 481 agccggggcc tgacccgttg gacacgagac gcttgcaggg ctttcggctg gaggagtatc 541 tgatagggca gtccattggt aagggctgca gtgctgctgt gtatgaagcc accatgccta 601 cattgcccca gaacctggag gtgacaaaga gcaccgggtt gcttccaggg agaggcccag 661 gtaccagtgc accaggagaa gggcaggagc gagctccggg ggcccctgcc ttccccttgg 721 ccatcaagat gatgtggaac atctcggcag gttcctccag cgaagccatc ttgaacacaa 781 tgagccagga gctggtccca gcgagccgag tggccttggc tggggagtat ggagcagtca 841 cttacagaaa atccaagaga ggtcccaagc aactagcccc tcaccccaac atcatccggg 901 ttctccgcgc cttcacctct tccgtgccgc tgctgccagg ggccctggtc gactaccctg 961 atgtgctgcc ctcacgcctc caccctgaag gcctgggcca tggccggacg ctgttcctcg 1021 ttatgaagaa ctatccctgt accctgcgcc agtacctttg tgtgaacaca cccagccccc 1081 gcctcgccgc catgatgctg ctgcagctgc tggaaggcgt ggaccatctg gttcaacagg 1141 gcatcgcgca cagagacctg aaatccgaca acatccttgt ggagctggac ccagacggct 1201 gcccctggct ggtgatcgca gattttggct gctgcctggc tgatgagagc atcggcctgc 1261 agttgccctt cagcagctgg tacgtggatc ggggcggaaa cggctgtctg atggccccag 1321 aggtgtccac ggcccgtcct ggccccaggg cagtgattga ctacagcaag gctgatgcct 1381 gggcagtggg agccatcgcc tatgaaatct tcgggcttgt caatcccttc tacggccagg 1441 gcaaggccca ccttgaaagc cgcagctacc aagaggctca gctaccTGCA CTGCCCGAGT 1501 CAGTGCCTCC AGACGTGAGA CAGTTGGTGA GGGCACTGCT CCAGCGAGAG GCCAGCAAGA 1561 GACCATCTGC CCGAGTAGCC GCAAATGTGC TTCATCTAAG CCTCTGGGGT GAACATATTC 1621 TAGCCCTGAA GAATCTGAAG TTAGACAAGA TGGTTGGCTG GCTCCTCCAA CAATCGGCCG 1681 CCACTTTGTT GGCCAACAGG CTCACAGAGA AGTGTTGTGT GGAAACAAAA ATGAAGATGC 1741 TCTTTCTGGC TAACCTGGAG TGTGAAACGC TCTGCCAGGC AGCCCTCCTC CTCTGCTCAT 1801 GGAGGGCAGC CCTGTAGGAC CCAGCTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1861 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1921 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAACGCACA CCTCCTACAC 1981 TTAAGCTACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt