Construct: ORF TRCN0000489497
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020203.1_s317c1
- DNA Barcode:
- CTTATTGTGAACTCGCTTGAAGTT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PFKM (5213)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489497
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_000289.6 | 100% | 100% | |
| 2 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001166687.1 | 100% | 100% | |
| 3 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001166688.1 | 100% | 100% | |
| 4 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354742.1 | 100% | 100% | |
| 5 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354743.1 | 100% | 100% | |
| 6 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354744.1 | 100% | 100% | |
| 7 | human | 5213 | PFKM | phosphofructokinase, muscle | XM_024449022.1 | 100% | 100% | |
| 8 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354741.1 | 98.9% | 98.9% | 1_24del |
| 9 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354745.1 | 96.2% | 96.2% | 0_1ins87 |
| 10 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001363619.1 | 96% | 96% | 843_844ins93 |
| 11 | human | 5213 | PFKM | phosphofructokinase, muscle | XM_024449021.1 | 95.9% | 95.9% | 1_99del |
| 12 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354746.1 | 94.6% | 94.6% | 934_935ins126 |
| 13 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354740.1 | 94.2% | 94.2% | 1_144del |
| 14 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354747.1 | 93.5% | 93.2% | 1_1delAins149;4C>T;7_8insTG |
| 15 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354748.1 | 93.5% | 93.2% | 1_1delAins149;4C>T;7_8insTG |
| 16 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001166686.2 | 91.6% | 91.6% | 1_213del |
| 17 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354737.1 | 91.6% | 91.6% | 1_213del |
| 18 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354738.1 | 91.6% | 91.6% | 1_213del |
| 19 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354739.1 | 91.6% | 91.6% | 1_213del |
| 20 | human | 5213 | PFKM | phosphofructokinase, muscle | XM_005268979.1 | 91.6% | 91.6% | 1_213del |
| 21 | human | 5213 | PFKM | phosphofructokinase, muscle | XM_024449020.1 | 91.3% | 91.3% | 1_222del |
| 22 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354735.1 | 88.3% | 88.3% | 1_309del |
| 23 | human | 5213 | PFKM | phosphofructokinase, muscle | NM_001354736.1 | 88.3% | 88.3% | 1_309del |
| 24 | human | 5213 | PFKM | phosphofructokinase, muscle | XM_005268974.1 | 88.3% | 88.3% | 1_309del |
| 25 | human | 5213 | PFKM | phosphofructokinase, muscle | XM_005268976.3 | 88.3% | 88.3% | 1_309del |
| 26 | human | 5213 | PFKM | phosphofructokinase, muscle | XM_017019469.1 | 88% | 88% | 1_213del;1056_1057ins93 |
| 27 | human | 5213 | PFKM | phosphofructokinase, muscle | XM_011538487.1 | 84.8% | 84.8% | 1_309del;1152_1153ins93 |
| 28 | human | 5213 | PFKM | phosphofructokinase, muscle | NR_148958.1 | 69.2% | 1_185del;1312_1466del;2681_3379del | |
| 29 | human | 5213 | PFKM | phosphofructokinase, muscle | NR_148954.1 | 67.3% | 1_185del;1029_1280del;2778_3476del | |
| 30 | human | 5213 | PFKM | phosphofructokinase, muscle | NR_148959.1 | 67% | (many diffs) | |
| 31 | human | 5213 | PFKM | phosphofructokinase, muscle | NR_148956.1 | 65.1% | (many diffs) | |
| 32 | human | 5213 | PFKM | phosphofructokinase, muscle | NR_148957.1 | 64.4% | (many diffs) | |
| 33 | human | 5213 | PFKM | phosphofructokinase, muscle | NR_148955.1 | 56.9% | (many diffs) | |
| 34 | mouse | 18642 | Pfkm | phosphofructokinase, muscle | NM_001163487.1 | 90.1% | 97.8% | (many diffs) |
| 35 | mouse | 18642 | Pfkm | phosphofructokinase, muscle | NM_001163488.1 | 90.1% | 97.8% | (many diffs) |
| 36 | mouse | 18642 | Pfkm | phosphofructokinase, muscle | NM_021514.4 | 90.1% | 97.8% | (many diffs) |
| 37 | mouse | 18642 | Pfkm | phosphofructokinase, muscle | XM_006520602.2 | 90.1% | 97.8% | (many diffs) |
| 38 | mouse | 18642 | Pfkm | phosphofructokinase, muscle | XM_006520601.3 | 82.7% | 89.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 2412
- ORF length:
- 2340
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgacccat gaagagcacc atgcagccaa aaccctgggg attggcaaag 121 ccattgctgt cttaacctct ggtggagatg cccaaggtat gaatgctgct gtcagggctg 181 tggttcgagt tggtatcttc accggtgccc gtgtcttctt tgtccatgag ggttatcaag 241 gcctggtgga tggtggagat cacatcaagg aagccacctg ggagagcgtt tcgatgatgc 301 ttcagctggg aggcacggtg attggaagtg cccggtgcaa ggactttcgg gaacgagaag 361 gacgactccg agctgcctac aacctggtga agcgtgggat caccaatctc tgtgtcattg 421 ggggtgatgg cagcctcact ggggctgaca ccttccgttc tgagtggagt gacttgttga 481 gtgacctcca gaaagcaggt aagatcacag atgaggaggc tacgaagtcc agctacctga 541 acattgtggg cctggttggg tcaattgaca atgacttctg tggcaccgat atgaccattg 601 gcactgactc tgccctgcat cggatcatgg aaattgtaga tgccatcact accactgccc 661 agagccacca gaggacattt gtgttagaag taatgggccg ccactgtgga tacctggccc 721 ttgtcacctc tctgtcctgt ggggccgact gggtttttat tcctgaatgt ccaccagatg 781 acgactggga ggaacacctt tgtcgccgac tcagcgagac aaggacccgt ggttctcgtc 841 tcaacatcat cattgtggct gagggtgcaa ttgacaagaa tggaaaacca atcacctcag 901 aagacatcaa gaatctggtg gttaagcgtc tgggatatga cacccgggtt actgtcttgg 961 ggcatgtgca gaggggtggg acgccatcag cctttgacag aattctgggc agcaggatgg 1021 gtgtggaagc agtgatggca cttttggagg ggaccccaga taccccagcc tgtgtagtga 1081 gcctctctgg taaccaggct gtgcgcctgc ccctcatgga atgtgtccag gtgaccaaag 1141 atgtgaccaa ggccatggat gagaagaaat ttgacgaagc cctgaagctg agaggccgga 1201 gcttcatgaa caactgggag gtgtacaagc ttctagctca tgtcagaccc ccggtatcta 1261 agagtggttc gcacacagtg gctgtgatga acgtgggggc tccggctgca ggcatgaatg 1321 ctgctgttcg ctccactgtg aggattggcc ttatccaggg caaccgagtg ctcgttgtcc 1381 atgatggttt cgagggcctg gccaaggggc agatagagga agctggctgg agctatgttg 1441 ggggctggac tggccaaggt ggctctaaac ttgggactaa aaggactcta cccaagaaga 1501 gctttgaaca gatcagtgcc aatataacta agtttaacat tcagggcctt gtcatcattg 1561 ggggctttga ggcttacaca gggggcctgg aactgatgga gggcaggaag cagtttgatg 1621 agctctgcat cccatttgtg gtcattcctg ctacagtctc caacaatgtc cctggctcag 1681 acttcagcgt tggggctgac acagcactca atactatctg cacaacctgt gaccgcatca 1741 agcagtcagc agctggcacc aagcgtcggg tgtttatcat tgagactatg ggtggctact 1801 gtggctacct ggctaccatg gctggactgg cagctggggc cgatgctgcc tacatttttg 1861 aggagccctt caccattcga gacctgcagg caaatgttga acatctggtg caaaagatga 1921 aaacaactgt gaaaaggggc ttggtgttaa ggaatgaaaa gtgcaatgag aactatacca 1981 ctgacttcat tttcaacctg tactctgagg aggggaaggg catcTTCGAC AGCAGGAAGA 2041 ATGTGCTTGG TCACATGCAG CAGGGTGGGA GCCCAACCCC ATTTGATAGG AATTTTGCCA 2101 CTAAGATGGG CGCCAAGGCT ATGAACTGGA TGTCTGGGAA AATCAAAGAG AGTTACCGTA 2161 ATGGGCGGAT CTTTGCCAAT ACTCCAGATT CGGGCTGTGT TCTGGGGATG CGTAAGAGGG 2221 CTCTGGTCTT CCAACCAGTG GCTGAGCTGA AGGACCAGAC AGATTTTGAG CATCGAATCC 2281 CCAAGGAACA GTGGTGGCTG AAACTGAGGC CCATCCTCAA AATCCTAGCC AAGTACGAGA 2341 TTGACTTGGA CACTTCAGAC CATGCCCACC TGGAGCACAT CACCCGGAAG CGGTCCGGGG 2401 AAGCTGCCGT CTGAGACCCA GCTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 2461 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 2521 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CTTATTGTGA ACTCGCTTGA 2581 AGTTACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt