Construct: ORF TRCN0000489557
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020343.1_s317c1
- DNA Barcode:
- CAAATATGAGGTCATATGGAGTCT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- CDK2 (1017)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489557
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1017 | CDK2 | cyclin dependent kinase 2 | NM_001798.5 | 100% | 100% | |
| 2 | human | 1017 | CDK2 | cyclin dependent kinase 2 | NM_052827.4 | 88.5% | 88.5% | 485_486ins102 |
| 3 | human | 1017 | CDK2 | cyclin dependent kinase 2 | XM_011537732.2 | 86.1% | 86.1% | 589_732del |
| 4 | human | 1017 | CDK2 | cyclin dependent kinase 2 | NM_001290230.2 | 79.8% | 79.8% | 116_117ins78;407_408ins102 |
| 5 | mouse | 12566 | Cdk2 | cyclin-dependent kinase 2 | NM_016756.4 | 92.5% | 98.9% | (many diffs) |
| 6 | mouse | 12566 | Cdk2 | cyclin-dependent kinase 2 | NM_183417.3 | 79.6% | 85.2% | (many diffs) |
| 7 | mouse | 12566 | Cdk2 | cyclin-dependent kinase 2 | XM_006513162.2 | 55.7% | 59.5% | (many diffs) |
| 8 | mouse | 12566 | Cdk2 | cyclin-dependent kinase 2 | XM_011243321.2 | 55.7% | 59.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 966
- ORF length:
- 894
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggagaac ttccaaaagg tggaaaagat cggagagggc acgtacggag 121 ttgtgtacaa agccagaaac aagttgacgg gagaggtggt ggcgcttaag aaaatccgcc 181 tggacactga gactgagggt gtgcccagta ctgccatccg agagatctct ctgcttaagg 241 agcttaacca tcctaatatt gtcaagctgc tggatgtcat tcacacagaa aataaactct 301 acctggtttt tgaatttctg caccaagatc tcaagaaatt catggatgcc tctgctctca 361 ctggcattcc tcttcccctc atcaagagct atctgttcca gctgctccag ggcctagctt 421 tctgccattc tcatcgggtc ctccaccgag accttaaacc tcagaatctg cttattaaca 481 cagagggggc catcaagcta gcagactttg gactagccag agcttttgga gtccctgttc 541 gtacttacac ccatgaggtg gtgaccctgt ggtaccgagc tcctgaaatc ctcctgggct 601 gcaaatatta ttccacagct gtggacatct ggagcctggg ctgcatcttt gctgagatgg 661 tgactcgccg ggccctattc cctggagatt cTGAGATTGA CCAGCTCTTC CGGATCTTTC 721 GGACTCTGGG GACCCCAGAT GAGGTGGTGT GGCCAGGAGT TACTTCTATG CCTGATTACA 781 AGCCAAGTTT CCCCAAGTGG GCCCGGCAAG ATTTTAGTAA AGTTGTACCT CCCCTGGATG 841 AAGATGGACG GAGCTTGTTA TCGCAAATGC TGCACTACGA CCCTAACAAG CGGATTTCGG 901 CCAAGGCAGC CCTGGCTCAC CCTTTCTTCC AGGATGTGAC CAAGCCAGTA CCCCATCTTC 961 GACTCTGAGA CCCAGCTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1021 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1081 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGACAAATA TGAGGTCATA TGGAGTCTAC 1141 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt