Construct: ORF TRCN0000489835
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019786.1_s317c1
- DNA Barcode:
- TAACCTGCGCCGCTAGTTGCTCCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AURKC (6795)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489835
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6795 | AURKC | aurora kinase C | NM_003160.3 | 99.8% | 99.6% | 825_826insG |
| 2 | human | 6795 | AURKC | aurora kinase C | NM_001015879.2 | 94.7% | 94.5% | 1_45del;870_871insG |
| 3 | human | 6795 | AURKC | aurora kinase C | NM_001015878.2 | 88.9% | 88.7% | 1_102del;927_928insG |
| 4 | human | 6795 | AURKC | aurora kinase C | XR_430209.3 | 41.2% | 1_1034del;1367_1371delGGTGA;1865_2000delinsG |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 900
- ORF length:
- 828
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgcggcgc ctcacagtcg atgactttga aatcgggcgt cccctgggca 121 aggggaaatt tgggaatgtg tacctggctc ggctcaagga aagccatttc attgtggccc 181 tgaaggttct cttcaagtcg cagatagaga aggaaggact ggagcaccag ctgcgccggg 241 aaattgagat ccaggctcat ctacaacacc ccaatatcct gcgcctgtat aactatttcc 301 atgatgcacg ccgggtgtac ctgattctgg aatatgctcc aaggggtgag ctctacaagg 361 agctgcagaa aagcgagaaa ttagatgaac agcgcacagc cacgataata gaggagttgg 421 cagatgccct gacctactgc catgacaaga aagtgattca cagagatatt aagccagaga 481 acctgctgct ggggttcagg ggtgaggtga agattgcaga ttttggctgg tctgtgcaca 541 ccccctccct gaggaggaag acaatgtgtg ggacactgga ctacttgccg ccagaaatga 601 ttgaggggag aacatatgat gaaaaggtgg atttgtggtg cattggagtg ctctgctatg 661 agctgctggt gggatatcca ccctttgaga gcgcctccca cagtgagact tacagacgca 721 tcctcaaggt agatgtgagg tttccactat caatgcctct gggggcccgg gacttgattt 781 ccaggcttct cagataccag cccttggaga gacTGCCCCT GGCCCAGATC CTGAAGCACC 841 CCTGGGTTCA GGCCCACTCC CGAAGGGTGC TGCCTCCCTG TGCTCAGATG GCTTCCGACC 901 CAGCTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 961 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1021 ATATATCTTG TGGAAAGGAC GATAACCTGC GCCGCTAGTT GCTCCGACGC GTTAAGTCga 1081 caatcaacct ctggattaca aaatttgtga aagatt