Construct: ORF TRCN0000489891
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021313.1_s317c1
- DNA Barcode:
- ATTCTTTTCAATCTAATATCTAAT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GPR87 (53836)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489891
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 53836 | GPR87 | G protein-coupled receptor 87 | NM_023915.4 | 74.9% | 75.1% | 1_267del;537A>G;1065C>T |
| 2 | mouse | 84111 | Gpr87 | G protein-coupled receptor 87 | XM_006502394.3 | 67.5% | 73% | (many diffs) |
| 3 | mouse | 84111 | Gpr87 | G protein-coupled receptor 87 | NM_001302203.1 | 65.8% | 71.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 879
- ORF length:
- 807
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgacgctg acatttccat ttcgaatagt ccatgatgca ggatttggac 121 cttggtactt caagtttatt ctctgcagat acacttcagt tttgttttat gcaaacatgt 181 atacttccat cgtgttcctt gggctgataa gcattgatcg ctatctgaag gtggtcaagc 241 catttgggga ctctcggatg tacagcataa ccttcacgaa ggttttatct gtttgtgttt 301 gggtgatcat ggctgttttg tctttgccaa acatcatcct gacaaatggt cagccaacag 361 aggacaatat ccatgactgc tcaaaactta aaagtccttt gggggtcaaa tggcatacgg 421 cagtcaccta tgtgaacagc tgcttgtttg tGGCCGTGCT GGTGATTCTG ATCGGATGTT 481 ACATAGCCAT ATCCAGGTAC ATCCACAAAT CCAGCAGGCA ATTCATAAGT CAGTCAAGCC 541 GAAAGCGAAA ACATAACCAG AGCATCAGGG TTGTTGTGGC TGTGTTTTTT ACCTGCTTTC 601 TACCATATCA CTTGTGCAGA ATTCCTTTTA CTTTTAGTCA CTTAGACAGG CTTTTAGATG 661 AATCTGCACA AAAAATCCTA TATTACTGCA AAGAAATTAC ACTTTTCTTG TCTGCGTGTA 721 ATGTTTGCCT GGATCCAATA ATTTACTTTT TCATGTGTAG GTCATTTTCA AGAAGGCTGT 781 TCAAAAAATC AAATATCAGA ACCAGGAGTG AAAGCATCAG ATCACTGCAA AGTGTGAGAA 841 GATCGGAAGT TCGCATATAT TATGATTATA CTGATGTGTA GAACCCAGCT TTCTTGTACA 901 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 961 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1021 AGGACGAATT CTTTTCAATC TAATATCTAA TACGCGTTAA GTCgacaatc aacctctgga 1081 ttacaaaatt tgtgaaagat t