Construct: ORF TRCN0000489898
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019160.1_s317c1
- DNA Barcode:
- ATTATACACGGTGCCTACTTTGAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- OXTR (5021)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489898
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5021 | OXTR | oxytocin receptor | NM_000916.3 | 99.9% | 99.7% | 1167_1168insG |
| 2 | human | 5021 | OXTR | oxytocin receptor | NM_001354653.1 | 99.9% | 99.7% | 1167_1168insG |
| 3 | human | 5021 | OXTR | oxytocin receptor | NM_001354654.1 | 99.9% | 99.7% | 1167_1168insG |
| 4 | human | 5021 | OXTR | oxytocin receptor | NM_001354655.1 | 99.9% | 99.7% | 1167_1168insG |
| 5 | human | 5021 | OXTR | oxytocin receptor | NM_001354656.2 | 99.9% | 99.7% | 1167_1168insG |
| 6 | mouse | 18430 | Oxtr | oxytocin receptor | NM_001081147.1 | 86.7% | 91.8% | (many diffs) |
| 7 | mouse | 18430 | Oxtr | oxytocin receptor | XM_006505723.1 | 86.7% | 91.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1245
- ORF length:
- 1170
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatggag ggcgcgctcg cagccaactg gagcgccgag gcagccaacg 121 ccagcgccgc gccgccgggg gccgagggca accgcaccgc cggacccccg cggcgcaacg 181 aggccctggc gcgcgtggag gtggcggtgc tgtgtctcat cctgctcctg gcgctgagcg 241 ggaacgcgtg tgtgctgctg gcgctgcgca ccacacgcca gaagcactcg cgcctcttct 301 tcttcatgaa gcacctaagc atcgccgacc tggtggtggc agtgtttcag gtgctgccgc 361 agttgctgtg ggacatcacc ttccgcttct acgggcccga cctgctgtgc cgcctggtca 421 agtacttgca ggtggtgggc atgttcgcct ccacctacct gctgctgctc atgtccctgg 481 accgctgcct ggccatctgc cagccgctgc gctcgctgcg ccgccgcacc gaccgcctgg 541 cagtgctcgc cacgtggctc ggctgcctgg tggccagcgc gccgcaggtg cacatcttct 601 ctctgcgcga ggtggctgac ggcgtcttcg actgctgggc cgtcttcatc cagccctggg 661 gacccaaggc ctacatcaca tggatcacgc tagctgtcta catcgtgccg gtcatcgtgc 721 tcgctgcctg ctacggcctt atcagcttca agatctggca gaacttgcgg ctcaagaccg 781 ctgcagcggc ggcggccGAG GCGCCAGAGG GCGCGGCGGC TGGCGATGGG GGGCGCGTGG 841 CCCTGGCGCG TGTCAGCAGC GTCAAGCTCA TCTCCAAGGC CAAGATCCGC ACGGTCAAGA 901 TGACTTTCAT CATCGTGCTG GCCTTCATCG TGTGCTGGAC GCCTTTCTTC TTCGTGCAGA 961 TGTGGAGCGT CTGGGATGCC AACGCGCCCA AGGAAGCCTC GGCCTTCATC ATCGTCATGC 1021 TCCTGGCCAG CCTCAACAGC TGCTGCAACC CCTGGATCTA CATGCTGTTC ACGGGCCACC 1081 TCTTCCACGA ACTCGTGCAG CGCTTCCTGT GCTGCTCCGC CAGCTACCTG AAGGGCAGAC 1141 GCCTGGGAGA GACGAGTGCC AGCAAAAAGA GCAACTCGTC CTCCTTTGTC CTGAGCCATC 1201 GCAGCTCCAG CCAGAGGAGC TGCTCCCAGC CATCCACGGC GGACCCAGCT TTCTTGTACA 1261 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1321 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1381 AGGACGAATT ATACACGGTG CCTACTTTGA AACGCGTTAA GTCgacaatc aacctctgga 1441 ttacaaaatt tgtgaaagat t