Construct: ORF TRCN0000491738
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020824.2_s317c1
- DNA Barcode:
- GACCATTGCGCACCTGAGCCTTTC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GPR87 (53836)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491738
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 53836 | GPR87 | G protein-coupled receptor 87 | NM_023915.4 | 99.8% | 100% | 138G>A;537A>G |
| 2 | mouse | 84111 | Gpr87 | G protein-coupled receptor 87 | NM_001302203.1 | 86.6% | 91.3% | (many diffs) |
| 3 | mouse | 84111 | Gpr87 | G protein-coupled receptor 87 | XM_006502394.3 | 83.9% | 88.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1146
- ORF length:
- 1074
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggggttc aacttgacgc ttgcaaaatt accaaataac gagctgcacg 121 gccaagagag tcacaattca ggcaacagga gcgacgggcc aggaaagaac accacccttc 181 acaatgaatt tgacacaatt gtcttgccag tgctttatct cattatattt gtggcaagca 241 tcttgctgaa tggtttagca gtgtggatct tcttccacat taggaataaa accagcttca 301 tattctatct caaaaacata gtggttgcag acctcataat gacgctgaca tttccatttc 361 gaatagtcca tgatgcagga tttggacctt ggtacttcaa gtttattctc tgcagataca 421 cttcagtttt gttttatgca aacatgtata cttccatcgt gttccttggg ctgataagca 481 ttgatcgcta tctgaaggtg gtcaagccat ttggggactc tcggatgtac agcataacct 541 tcacgaaggt tttatctgtt tgtgtttggg tgatcatggc tgttttgtct ttgccaaaca 601 tcatcctgac aaatggtcag ccaacagagg acaatatcca tgactgctca aaacttaaaa 661 gtcctttggg ggtcaaatgg catacggcag tcacctatgt gaacagctgc ttgtttgtgg 721 ccgtgctggt gattctgatc ggatgttaca tagccatatc caggtacatc cacaaatcca 781 gcaggcaatT CATAAGTCAG TCAAGCCGAA AGCGAAAACA TAACCAGAGC ATCAGGGTTG 841 TTGTGGCTGT GTTTTTTACC TGCTTTCTAC CATATCACTT GTGCAGAATT CCTTTTACTT 901 TTAGTCACTT AGACAGGCTT TTAGATGAAT CTGCACAAAA AATCCTATAT TACTGCAAAG 961 AAATTACACT TTTCTTGTCT GCGTGTAATG TTTGCCTGGA TCCAATAATT TACTTTTTCA 1021 TGTGTAGGTC ATTTTCAAGA AGGCTGTTCA AAAAATCAAA TATCAGAACC AGGAGTGAAA 1081 GCATCAGATC ACTGCAAAGT GTGAGAAGAT CGGAAGTTCG CATATATTAT GATTACACTG 1141 ATGTGTAGGA CCCAGCTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1201 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1261 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAGACCAT TGCGCACCTG AGCCTTTCAC 1321 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt