Construct: ORF TRCN0000491862
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016623.2_s317c1
- Derived from:
- ccsbBroadEn_13314
- DNA Barcode:
- AACTCTAAGTTAGGGACACTCACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PATE1 (160065)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491862
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 160065 | PATE1 | prostate and testis express... | NM_138294.3 | 90.2% | 89.6% | 88_123del;140A>G |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 411
- ORF length:
- 342
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggacaagtcc ctcttgctgg aactccccat cctgctctgc tgctttaggg 121 cattatctgg atcactttca atgagaaatg atgcagtgat agaaattgtt cggtgtagga 181 tgtgccacct ccagttccca ggagaaaagt gctccagagg aagaggaata tgcacagcaa 241 caacagaaga ggcctgcatg gttggaagga tgttcaaaag ggatggtaat CCCTGGTTAA 301 CCTTCATGGG CTGCCTAAAG AACTGTGCTG ATGTGAAAGG CATAAGGTGG AGTGTCTATT 361 TGGTGAACTT CAGGTGCTGC AGGAGCCATG ACCTGTGCAA TGAAGACCTT TTGCCAACTT 421 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 481 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 541 CTTGTGGAAA GGACGAAACT CTAAGTTAGG GACACTCACA ACGCGTTAAG TCgacaatca 601 acctctggat tacaaaattt gtgaaagatt