Construct: ORF TRCN0000491929
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017248.4_s317c1
- Derived from:
- ccsbBroadEn_01277
- DNA Barcode:
- AGCCGGGAACCATATATCGTCCTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PRKAB2 (5565)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491929
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 5565 | PRKAB2 | protein kinase AMP-activate... | NM_005399.5 | 100% | 100% | |
2 | human | 5565 | PRKAB2 | protein kinase AMP-activate... | XM_011509729.2 | 88.8% | 91.5% | 742_778del;795_796ins58 |
3 | human | 5565 | PRKAB2 | protein kinase AMP-activate... | XM_017001697.2 | 72.4% | 54.2% | 413_414ins121;591_592ins104 |
4 | human | 5565 | PRKAB2 | protein kinase AMP-activate... | NR_103871.2 | 12.1% | 1_65del;219_220ins167;715_5176del | |
5 | human | 5565 | PRKAB2 | protein kinase AMP-activate... | XR_001737291.2 | 12.1% | 1_961del;1701_2185del;2263_6724del | |
6 | human | 5565 | PRKAB2 | protein kinase AMP-activate... | XR_001737292.2 | 11.2% | (many diffs) | |
7 | human | 5565 | PRKAB2 | protein kinase AMP-activate... | NR_103870.2 | 9.8% | (many diffs) | |
8 | mouse | 108097 | Prkab2 | protein kinase, AMP-activat... | NM_182997.2 | 90.9% | 97% | (many diffs) |
9 | mouse | 108097 | Prkab2 | protein kinase, AMP-activat... | XM_006500840.1 | 90.9% | 97% | (many diffs) |
10 | mouse | 108097 | Prkab2 | protein kinase, AMP-activat... | XM_011239982.2 | 90.9% | 97% | (many diffs) |
11 | mouse | 108097 | Prkab2 | protein kinase, AMP-activat... | XM_006500841.1 | 75.5% | 79.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 882
- ORF length:
- 816
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg aaacaccacc agcgaccggg tgtccgggga gcgccacggc gccaaggctg 121 cacgctccga gggcgcaggc ggccatgccc cggggaagga gcacaagatc atggtgggga 181 gtacggacga ccccagcgtg ttcagcctcc ctgactccaa gctccctggg gacaaagagt 241 ttgtatcatg gcagcaggat ttggaggact ccgtaaagcc cacacagcag gcccggccca 301 ctgttatccg ctggtctgaa ggaggcaagg aggtcttcat ctctgggtcc ttcaacaatt 361 ggagcaccaa gattccactg attaagagcc ataatgactt tgttgccatc ctggacctcc 421 ctgagggaga gcaccaatac aagttctttg tggatggaca gtgggttcat gatccatcag 481 agcctgtggt taccagtcag cttggcacaa ttaacaattt gatccatgtc aagaaatctg 541 attttgaggt gttcgatgct ttaaagttag attctatgga aagttctgag acatcttgta 601 gagacctttc cagctcaccc ccagggcctt atggtcaaga aatgtatgcg tttcgatctg 661 aggaaaGATT CAAATCCCCA CCCATCCTTC CTCCTCATCT ACTTCAAGTT ATTCTTAACA 721 AAGACACTAA TATTTCTTGT GACCCAGCCT TACTCCCTGA GCCCAACCAT GTTATGCTGA 781 ACCATCTCTA TGCATTGTCC ATTAAGGACA GTGTGATGGT CCTTAGCGCA ACCCATCGCT 841 ACAAGAAGAA GTATGTTACT ACTCTGCTAT ACAAGCCCAT TTGCCCAACT TTCTTGTACA 901 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 961 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1021 AGGACGAAGC CGGGAACCAT ATATCGTCCT GACGCGTTAA GTCgacaatc aacctctgga 1081 ttacaaaatt tgtgaaagat t