Gene: Mouse Dbpht1 (20749)

This gene has been discontinued and we have no replacement information available at this time.

shRNA constructs designed to target this gene

The following shRNA constructs were originally designed to target this discontinued gene.

Target Taxon[?] Target Gene ID Target Gene Symbol Clone ID Target Seq Vector Target Transcript Match Position Match Region[?] Intrinsic Score[?] Adjusted Score[?] Addgene[?]
1 mouse 20749 Dbpht1 TRCN0000173612 GAGAGCACAACTTTGACTCAA pLKO.1 NM_019416.1 625 CDS 4.950 n/a
2 mouse 20749 Dbpht1 TRCN0000173505 GCACACATTTCAGTACACTGT pLKO.1 NM_019416.1 598 CDS 2.640 n/a
3 mouse 20749 Dbpht1 TRCN0000173526 GCTTGTCTATCATCTCAGCAT pLKO.1 NM_019416.1 1106 3UTR 2.640 n/a
4 mouse 20749 Dbpht1 TRCN0000176152 GTATACACATACACACACACA pLKO.1 NM_019416.1 746 CDS 2.640 n/a
Download CSV

Additional Resources:

NBCI Gene record:
Dbpht1 (20749)