Gene: Mouse LOC433799 (433799)

This gene has been discontinued and we have no replacement information available at this time.

shRNA constructs designed to target this gene

The following shRNA constructs were originally designed to target this discontinued gene.

Target Taxon[?] Target Gene ID Target Gene Symbol Clone ID Target Seq Vector Target Transcript Match Position Match Region[?] Intrinsic Score[?] Adjusted Score[?] Addgene[?]
1 mouse 100043012 Gm4169 TRCN0000092880 CTGAGCAATCTGCCAAAGATA pLKO.1 XM_485496.1 557 CDS 5.625 n/a
2 mouse 100043012 Gm4169 TRCN0000092879 GACAGGGAGATGAAGAACTAT pLKO.1 XM_485496.1 370 CDS 5.625 n/a
3 mouse 100043012 Gm4169 TRCN0000092882 CAAGAGCGACAAAGCTCGTTA pLKO.1 XM_485496.1 348 CDS 4.950 n/a
4 mouse 100043012 Gm4169 TRCN0000092878 GCTGTCCTAAAGTGTGGAGTA pLKO.1 XM_485496.1 793 3UTR 4.050 n/a
5 mouse 100043012 Gm4169 TRCN0000092881 GAGGAAGATGAAGAGGAGGAA pLKO.1 XM_485496.1 751 CDS 2.640 n/a
Download CSV

Additional Resources:

NBCI Gene record:
LOC433799 (433799)