Gene: Mouse LOC235882 (235882)

This gene has been discontinued and we have no replacement information available at this time.

shRNA constructs designed to target this gene

The following shRNA constructs were originally designed to target this discontinued gene.

Target Taxon[?] Target Gene ID Target Gene Symbol Clone ID Target Seq Vector Target Transcript Match Position Match Region[?] Intrinsic Score[?] Adjusted Score[?] Addgene[?]
1 mouse 235882 LOC235882 TRCN0000243547 TCTTAAAGACCTTGCTAATAA pLKO_005 XM_135380.6 219 CDS 15.000 n/a
2 mouse 235882 LOC235882 TRCN0000243545 ATCAGTTTAGGACAGTCAAAT pLKO_005 XM_135380.6 56 CDS 13.200 n/a
3 mouse 235882 LOC235882 TRCN0000257201 TGGACTAGACAAACTGATAAA pLKO_005 XM_135380.6 177 CDS 13.200 n/a
4 mouse 235882 LOC235882 TRCN0000243548 CAGACTGGATGGAGGACAAGT pLKO_005 XM_135380.6 143 CDS 4.950 n/a
5 mouse 235882 LOC235882 TRCN0000243546 GAAGATTATGACAGGATTCAG pLKO_005 XM_135380.6 118 CDS 4.950 n/a
Download CSV

Additional Resources:

NBCI Gene record:
LOC235882 (235882)