Gene: Mouse EG667784 (667784)

This gene has been discontinued and we have no replacement information available at this time.

shRNA constructs designed to target this gene

The following shRNA constructs were originally designed to target this discontinued gene.

	Target Taxon	Target Gene ID	Target Gene Symbol	Clone ID	Target Seq	Vector	Target Transcript	Match Position	Match Region	Intrinsic Score	Adjusted Score	Addgene
1	mouse	667784	EG667784	TRCN0000235227	CAGAGTTTGGAGGACAATAAT	pLKO_005	XM_992423.1	43	CDS	15.000		n/a
2	mouse	667784	EG667784	TRCN0000235229	TGACCATCTTTATCCTAATTT	pLKO_005	XM_992423.1	99	CDS	15.000		n/a
3	mouse	667784	EG667784	TRCN0000235230	CTCAAACAGAAGCAAAGATTT	pLKO_005	XM_992423.1	139	CDS	13.200		n/a
4	mouse	667784	EG667784	TRCN0000235228	GTTGTCCCAAGTGTAATTATG	pLKO_005	XM_992423.1	65	CDS	13.200		n/a
5	mouse	667784	EG667784	TRCN0000235231	GAGTAGCACCAATGGGCATAG	pLKO_005	XM_992423.1	192	CDS	6.000		n/a

Additional Resources:

• NBCI Gene record: EG667784 (667784)