Transcript: Human NM_000091.5

Homo sapiens collagen type IV alpha 3 chain (COL4A3), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
COL4A3 (1285)
Length:
8038
CDS:
104..5116

Additional Resources:

NCBI RefSeq record:
NM_000091.5
NBCI Gene record:
COL4A3 (1285)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000091.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432010 GAGGAACGTGCAACTACTATT pLKO_005 4959 CDS 100% 13.200 18.480 N COL4A3 n/a
2 TRCN0000083487 GCGATTTACCACAATGCCATT pLKO.1 4588 CDS 100% 4.050 5.670 N COL4A3 n/a
3 TRCN0000424068 CCATGATGACTTAGTACAAAG pLKO_005 5220 3UTR 100% 10.800 7.560 N COL4A3 n/a
4 TRCN0000438406 GAACCAGGACTGCGTGGTATA pLKO_005 3122 CDS 100% 10.800 7.560 N COL4A3 n/a
5 TRCN0000083486 CCAGGTTTAAAGGGCCTCAAA pLKO.1 3035 CDS 100% 4.950 3.465 N COL4A3 n/a
6 TRCN0000083484 CCAATGAACATGGCTCCCATT pLKO.1 4691 CDS 100% 4.050 2.835 N COL4A3 n/a
7 TRCN0000083485 GCTGCTGGTTTGAAAGGACAA pLKO.1 548 CDS 100% 4.050 2.835 N COL4A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000091.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.