Transcript: Human NM_000111.3

Homo sapiens solute carrier family 26 member 3 (SLC26A3), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
SLC26A3 (1811)
Length:
2882
CDS:
202..2496

Additional Resources:

NCBI RefSeq record:
NM_000111.3
NBCI Gene record:
SLC26A3 (1811)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000111.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413509 GATTACGTAATCGGGTATATG pLKO_005 2450 CDS 100% 13.200 18.480 N SLC26A3 n/a
2 TRCN0000020179 GCGGATTGGATTTGTAGTGAT pLKO.1 789 CDS 100% 4.950 6.930 N SLC26A3 n/a
3 TRCN0000430548 TTGCCAGCATACCGGCTTAAA pLKO_005 391 CDS 100% 13.200 10.560 N SLC26A3 n/a
4 TRCN0000020182 GCAGCTAGTGTGGCATTTCAA pLKO.1 1666 CDS 100% 5.625 4.500 N SLC26A3 n/a
5 TRCN0000020183 GCAATGCAACTACTTTGGGAT pLKO.1 656 CDS 100% 2.640 2.112 N SLC26A3 n/a
6 TRCN0000425986 ATGCAGCACGCTGGCTAATAT pLKO_005 1722 CDS 100% 15.000 10.500 N SLC26A3 n/a
7 TRCN0000412961 TGGTTCTAGCATGGCATATTT pLKO_005 2631 3UTR 100% 15.000 10.500 N SLC26A3 n/a
8 TRCN0000020181 CCAGCGTCTATTCCCTCAAAT pLKO.1 1274 CDS 100% 13.200 9.240 N SLC26A3 n/a
9 TRCN0000020180 CCTTTCCACATTGACTGGAAT pLKO.1 2077 CDS 100% 0.495 0.347 N SLC26A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000111.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.