Transcript: Human NM_000129.4

Homo sapiens coagulation factor XIII A chain (F13A1), mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
F13A1 (2162)
Length:
3828
CDS:
95..2293

Additional Resources:

NCBI RefSeq record:
NM_000129.4
NBCI Gene record:
F13A1 (2162)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000129.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372206 TTAAGCTCTCATAGCTCATAA pLKO_005 2536 3UTR 100% 13.200 18.480 N F13A1 n/a
2 TRCN0000055631 GCGTTGACATTCTATTGGAAT pLKO.1 981 CDS 100% 4.950 6.930 N F13A1 n/a
3 TRCN0000372150 GAGATGGCATGATGGATATTA pLKO_005 1509 CDS 100% 15.000 10.500 N F13A1 n/a
4 TRCN0000055630 GCCACCCACATTGGGAAATTA pLKO.1 1466 CDS 100% 15.000 10.500 N F13A1 n/a
5 TRCN0000055632 GCTGGTGTCTTTAACACATTT pLKO.1 1049 CDS 100% 13.200 9.240 N F13A1 n/a
6 TRCN0000372152 GTTCCACCCAATAACTCTAAT pLKO_005 137 CDS 100% 13.200 9.240 N F13A1 n/a
7 TRCN0000055629 GCAGTCTTTCTATGTGCAGAT pLKO.1 334 CDS 100% 4.050 2.835 N F13A1 n/a
8 TRCN0000055628 CCAGCAAGAATTGTTACCAAT pLKO.1 1088 CDS 100% 4.950 2.970 N F13A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000129.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.