Transcript: Human NM_000187.4

Homo sapiens homogentisate 1,2-dioxygenase (HGD), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
HGD (3081)
Length:
1674
CDS:
129..1466

Additional Resources:

NCBI RefSeq record:
NM_000187.4
NBCI Gene record:
HGD (3081)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000187.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000284753 CAGGTGGTTACACGGTCATTA pLKO_005 847 CDS 100% 13.200 18.480 N HGD n/a
2 TRCN0000000189 CTCATGCTTTCTGGTAGTATT pLKO.1 1522 3UTR 100% 13.200 9.240 N HGD n/a
3 TRCN0000272421 CTCATGCTTTCTGGTAGTATT pLKO_005 1522 3UTR 100% 13.200 9.240 N HGD n/a
4 TRCN0000000193 AGGGAGTCTACACAGCACAAT pLKO.1 1211 CDS 100% 4.950 3.465 N HGD n/a
5 TRCN0000272420 AGGGAGTCTACACAGCACAAT pLKO_005 1211 CDS 100% 4.950 3.465 N HGD n/a
6 TRCN0000076361 CTTCTCATTTACACCGAGTTT pLKO.1 615 CDS 100% 4.950 3.465 N Hgd n/a
7 TRCN0000000191 TGATGCTGACTGCTTTGAGAA pLKO.1 1247 CDS 100% 4.950 3.465 N HGD n/a
8 TRCN0000272473 TGTCCACGGAGCACCAATAAG pLKO_005 279 CDS 100% 13.200 7.920 N HGD n/a
9 TRCN0000000190 CGTGATTTCTTGATACCCATT pLKO.1 801 CDS 100% 4.050 2.430 N HGD n/a
10 TRCN0000000192 ACAAGTACAACCTGAAGAATT pLKO.1 952 CDS 100% 0.000 0.000 N HGD n/a
11 TRCN0000272472 ACAAGTACAACCTGAAGAATT pLKO_005 952 CDS 100% 0.000 0.000 N HGD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000187.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.