Transcript: Human NM_000232.4

Homo sapiens sarcoglycan beta (SGCB), mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
SGCB (6443)
Length:
4295
CDS:
61..1017

Additional Resources:

NCBI RefSeq record:
NM_000232.4
NBCI Gene record:
SGCB (6443)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000232.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062449 CGTGCTATTGTGCGTGGAAAT pLKO.1 727 CDS 100% 10.800 15.120 N SGCB n/a
2 TRCN0000062450 GCTGGATACATTCCGATTGAT pLKO.1 184 CDS 100% 5.625 7.875 N SGCB n/a
3 TRCN0000062452 GCGTGGAAATGAAGGTGTATT pLKO.1 738 CDS 100% 13.200 10.560 N SGCB n/a
4 TRCN0000298827 GCGTGGAAATGAAGGTGTATT pLKO_005 738 CDS 100% 13.200 10.560 N SGCB n/a
5 TRCN0000295995 TCTTCTCAGAGAGCCTAAATT pLKO_005 1166 3UTR 100% 15.000 10.500 N SGCB n/a
6 TRCN0000308021 AGTGGCCTGCTTCGATTTAAG pLKO_005 373 CDS 100% 13.200 9.240 N SGCB n/a
7 TRCN0000062448 CCTGACAAATAAGAGATCATT pLKO.1 4071 3UTR 100% 5.625 3.938 N SGCB n/a
8 TRCN0000062451 CGCTCTTCAAGGTGCAAGTAA pLKO.1 941 CDS 100% 5.625 3.375 N SGCB n/a
9 TRCN0000298826 CGCTCTTCAAGGTGCAAGTAA pLKO_005 941 CDS 100% 5.625 3.375 N SGCB n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3555 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3555 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000232.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.