Transcript: Human NM_000250.2

Homo sapiens myeloperoxidase (MPO), mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
MPO (4353)
Length:
3216
CDS:
178..2415

Additional Resources:

NCBI RefSeq record:
NM_000250.2
NBCI Gene record:
MPO (4353)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000250.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436663 CCACGTACCGTTCCTACAATG pLKO_005 1607 CDS 100% 10.800 15.120 N MPO n/a
2 TRCN0000046003 CGTGTCTAAGAACAACATCTT pLKO.1 2310 CDS 100% 4.950 6.930 N MPO n/a
3 TRCN0000046004 CGCTCACTCATGTTCATGCAA pLKO.1 919 CDS 100% 3.000 4.200 N MPO n/a
4 TRCN0000422301 CTCATGTATGTGCGAAGTATA pLKO_005 2556 3UTR 100% 13.200 10.560 N MPO n/a
5 TRCN0000424211 TGAGTGACTAGACGTTCATTT pLKO_005 2530 3UTR 100% 13.200 10.560 N MPO n/a
6 TRCN0000417057 TGAATCGTCAGAACCAAATTG pLKO_005 1847 CDS 100% 13.200 9.240 N MPO n/a
7 TRCN0000046005 GCGATTGTTTGAGCAGGTCAT pLKO.1 1887 CDS 100% 4.050 2.835 N MPO n/a
8 TRCN0000046007 GAACCTGAAATTGGCGAGGAA pLKO.1 2043 CDS 100% 2.640 1.848 N MPO n/a
9 TRCN0000046006 GCAGGACAAATACCGCACCAT pLKO.1 684 CDS 100% 2.640 1.848 N MPO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000250.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.