Transcript: Human NM_000299.3

Homo sapiens plakophilin 1 (PKP1), transcript variant 1b, mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
PKP1 (5317)
Length:
5447
CDS:
252..2495

Additional Resources:

NCBI RefSeq record:
NM_000299.3
NBCI Gene record:
PKP1 (5317)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000299.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427573 GACAACTCCACGTTGGCTTTG pLKO_005 306 CDS 100% 6.000 8.400 N PKP1 n/a
2 TRCN0000118862 CGACAAGATGATGAACAACAA pLKO.1 1805 CDS 100% 4.950 6.930 N PKP1 n/a
3 TRCN0000118863 GCAAGGTTTCGATAGGAACAT pLKO.1 2420 CDS 100% 4.950 6.930 N PKP1 n/a
4 TRCN0000421155 GTGAGTGTCTTAAAGCATAAC pLKO_005 2841 3UTR 100% 10.800 7.560 N PKP1 n/a
5 TRCN0000118865 GCAGGTGATGATGACCGTCAA pLKO.1 380 CDS 100% 4.050 2.835 N PKP1 n/a
6 TRCN0000118866 GTTGTACCATTCAGATGCCAT pLKO.1 1877 CDS 100% 2.640 1.848 N PKP1 n/a
7 TRCN0000118864 GACATCTGCTTCATGCAGAAA pLKO.1 678 CDS 100% 0.495 0.347 N PKP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000299.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.