Transcript: Human NM_000330.4

Homo sapiens retinoschisin 1 (RS1), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
RS1 (6247)
Length:
3031
CDS:
41..715

Additional Resources:

NCBI RefSeq record:
NM_000330.4
NBCI Gene record:
RS1 (6247)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000330.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083668 GCGCCTGAACTGGATTTACTA pLKO.1 517 CDS 100% 5.625 7.875 N RS1 n/a
2 TRCN0000083672 CGATGAGTGGATGACCAAGTA pLKO.1 472 CDS 100% 4.950 3.960 N RS1 n/a
3 TRCN0000418610 ATGAAGCCACATTGGGATTAT pLKO_005 87 CDS 100% 13.200 9.240 N RS1 n/a
4 TRCN0000423747 TTCATTTGCTTTACCACATTC pLKO_005 1072 3UTR 100% 10.800 7.560 N RS1 n/a
5 TRCN0000083669 CCTTGGACTGTATACCAGAAT pLKO.1 207 CDS 100% 4.950 3.465 N RS1 n/a
6 TRCN0000083671 CGGCTCAACAGTCAAGGCTTT pLKO.1 344 CDS 100% 4.050 2.835 N RS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000330.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.