Transcript: Human NM_000341.4

Homo sapiens solute carrier family 3 member 1 (SLC3A1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SLC3A1 (6519)
Length:
2969
CDS:
57..2114

Additional Resources:

NCBI RefSeq record:
NM_000341.4
NBCI Gene record:
SLC3A1 (6519)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000341.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419294 ATTTCGGGCCTTCCCGCTAAA pLKO_005 1887 CDS 100% 10.800 15.120 N SLC3A1 n/a
2 TRCN0000043415 GCCATACATGATAAAGGTTTA pLKO.1 651 CDS 100% 10.800 15.120 N SLC3A1 n/a
3 TRCN0000424199 CACGAGTGATAAACATATTTG pLKO_005 701 CDS 100% 13.200 10.560 N SLC3A1 n/a
4 TRCN0000433904 AGATCGGCTTTGAAGTTATAT pLKO_005 1692 CDS 100% 15.000 10.500 N SLC3A1 n/a
5 TRCN0000433004 TCTCAATGAAAGCTATGATAT pLKO_005 1535 CDS 100% 13.200 9.240 N SLC3A1 n/a
6 TRCN0000043414 CCAAGTAAATAAGACCCAAAT pLKO.1 1043 CDS 100% 10.800 7.560 N SLC3A1 n/a
7 TRCN0000043417 GCTTTCAGAGATAGATGCTTT pLKO.1 2037 CDS 100% 4.950 3.465 N SLC3A1 n/a
8 TRCN0000043416 CCATTTATCCAAGAAGCTGAT pLKO.1 1254 CDS 100% 4.050 2.835 N SLC3A1 n/a
9 TRCN0000043413 CCTATAACTTACTATGGAGAA pLKO.1 1482 CDS 100% 4.050 2.835 N SLC3A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000341.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.