Transcript: Human NM_000350.3

Homo sapiens ATP binding cassette subfamily A member 4 (ABCA4), mRNA.

Source:
NCBI, updated 2019-09-18
Taxon:
Homo sapiens (human)
Gene:
ABCA4 (24)
Length:
7328
CDS:
104..6925

Additional Resources:

NCBI RefSeq record:
NM_000350.3
NBCI Gene record:
ABCA4 (24)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000350.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059373 CGTGAAGTATAAGATCCGAAT pLKO.1 1801 CDS 100% 4.050 5.670 N ABCA4 n/a
2 TRCN0000425456 GGTTGCAAACTGGAGTATTAA pLKO_005 6250 CDS 100% 15.000 10.500 N ABCA4 n/a
3 TRCN0000423663 ACGTTAGGAAGTTGGTCAAAG pLKO_005 1371 CDS 100% 10.800 7.560 N ABCA4 n/a
4 TRCN0000059376 GCTGAGCACATGCTGTTCTAT pLKO.1 3164 CDS 100% 5.625 3.938 N ABCA4 n/a
5 TRCN0000059374 CCCATTGTTGATGAAGATGAT pLKO.1 5840 CDS 100% 4.950 3.465 N ABCA4 n/a
6 TRCN0000059377 CCGTCTGAACATCACCTTCTA pLKO.1 2944 CDS 100% 4.950 3.465 N ABCA4 n/a
7 TRCN0000059375 CCTACATTACAGCGACCCATT pLKO.1 2275 CDS 100% 4.050 2.835 N ABCA4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000350.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.