Transcript: Human NM_000379.4

Homo sapiens xanthine dehydrogenase (XDH), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
XDH (7498)
Length:
5715
CDS:
77..4078

Additional Resources:

NCBI RefSeq record:
NM_000379.4
NBCI Gene record:
XDH (7498)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000379.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435638 ACAGAACATGGATCTATTAAA pLKO_005 4146 3UTR 100% 15.000 10.500 N XDH n/a
2 TRCN0000412906 ACCTTGAATCTATACTCAAAT pLKO_005 4535 3UTR 100% 13.200 9.240 N XDH n/a
3 TRCN0000437402 TCAATGGACAGGCCGTCTATG pLKO_005 3333 CDS 100% 10.800 7.560 N XDH n/a
4 TRCN0000028034 GCCAAGATCAAGTCCATAGAT pLKO.1 1922 CDS 100% 5.625 3.938 N XDH n/a
5 TRCN0000028094 CCAGGATCTCTCTCAGAGTAT pLKO.1 2689 CDS 100% 4.950 3.465 N XDH n/a
6 TRCN0000028098 GCAACTTTACTGTTTCAGAAA pLKO.1 1712 CDS 100% 4.950 3.465 N XDH n/a
7 TRCN0000028089 GCTATAAAGAACAACTCCTTT pLKO.1 2180 CDS 100% 4.950 3.465 N XDH n/a
8 TRCN0000028064 GCACACAGGTAATAACGTGAA pLKO.1 3931 CDS 100% 4.050 2.835 N XDH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000379.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.