Transcript: Human NM_000417.3

Homo sapiens interleukin 2 receptor subunit alpha (IL2RA), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
IL2RA (3559)
Length:
3218
CDS:
217..1035

Additional Resources:

NCBI RefSeq record:
NM_000417.3
NBCI Gene record:
IL2RA (3559)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000417.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059163 CCTCGTCACAACAACAGATTT pLKO.1 855 CDS 100% 13.200 18.480 N IL2RA n/a
2 TRCN0000427499 ACTCGGAACACAACGAAACAA pLKO_005 475 CDS 100% 5.625 7.875 N IL2RA n/a
3 TRCN0000415577 ACCCTATACAACTGGACATTG pLKO_005 1480 3UTR 100% 10.800 8.640 N IL2RA n/a
4 TRCN0000059166 CTGTGAATGCAAGAGAGGTTT pLKO.1 360 CDS 100% 4.950 3.960 N IL2RA n/a
5 TRCN0000059165 GCCACAGAGAGAATTTATCAT pLKO.1 619 CDS 100% 5.625 3.938 N IL2RA n/a
6 TRCN0000059164 CCTCAACCTGAAGAACAGAAA pLKO.1 502 CDS 100% 4.950 3.465 N IL2RA n/a
7 TRCN0000059167 GTCCATATTTACAACAGAGTA pLKO.1 912 CDS 100% 4.950 3.465 N IL2RA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000417.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.