Transcript: Human NM_000426.3

Homo sapiens laminin subunit alpha 2 (LAMA2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
LAMA2 (3908)
Length:
9708
CDS:
106..9474

Additional Resources:

NCBI RefSeq record:
NM_000426.3
NBCI Gene record:
LAMA2 (3908)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000426.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083853 CGGCTAATAGATAAACTCAAA pLKO.1 6427 CDS 100% 4.950 6.930 N LAMA2 n/a
2 TRCN0000083855 GCTGCCTCAAAGATATTGAAA pLKO.1 7586 CDS 100% 5.625 3.938 N LAMA2 n/a
3 TRCN0000083854 CCACTCAATATCCCATCCAAT pLKO.1 2533 CDS 100% 4.950 3.465 N LAMA2 n/a
4 TRCN0000083856 GCAATGTAAATACAGGCCAAT pLKO.1 3320 CDS 100% 4.050 2.835 N LAMA2 n/a
5 TRCN0000083857 GCTCCCTATCTGGGAAACAAA pLKO.1 1867 CDS 100% 5.625 3.375 N LAMA2 n/a
6 TRCN0000431973 TGGACCCAAAGCCAGCATTTC pLKO_005 6852 CDS 100% 10.800 7.560 N Vill n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000426.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.