Transcript: Human NM_000496.3

Homo sapiens crystallin beta B2 (CRYBB2), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CRYBB2 (1415)
Length:
769
CDS:
55..672

Additional Resources:

NCBI RefSeq record:
NM_000496.3
NBCI Gene record:
CRYBB2 (1415)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000496.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438138 GAAGGCAGGTTCTGTCCTAGT pLKO_005 195 CDS 100% 4.050 5.670 N CRYBB2 n/a
2 TRCN0000083562 CGTGCGCCGTATCCGCGACAT pLKO.1 612 CDS 100% 0.000 0.000 N CRYBB2 n/a
3 TRCN0000083561 ATCATCATCTTTGAGCAGGAA pLKO.1 109 CDS 100% 2.640 1.848 N CRYBB2 n/a
4 TRCN0000083559 CACCGGGAAGAAGATGGAAAT pLKO.1 405 CDS 100% 10.800 5.400 Y CRYBB2 n/a
5 TRCN0000083560 GAAATCATAGATGACGATGTA pLKO.1 421 CDS 100% 4.950 2.475 Y CRYBB2 n/a
6 TRCN0000083558 GAGCACAAGATCATCCTCTAT pLKO.1 370 CDS 100% 4.950 2.475 Y CRYBB2 n/a
7 TRCN0000008523 CCCATCAAAGTGGACAGCCAA pLKO.1 349 CDS 100% 2.640 1.320 Y Crybb2 n/a
8 TRCN0000011445 GCGAGCAGTTTGTGTTTGAAA pLKO.1 260 CDS 100% 5.625 2.813 Y Crybb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000496.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.