Transcript: Human NM_000506.5

Homo sapiens coagulation factor II, thrombin (F2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
F2 (2147)
Length:
1990
CDS:
24..1892

Additional Resources:

NCBI RefSeq record:
NM_000506.5
NBCI Gene record:
F2 (2147)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000506.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372208 TAACAACCGCTGGTATCAAAT pLKO_005 1757 CDS 100% 13.200 18.480 N F2 n/a
2 TRCN0000003632 GCATGTCTGGAAGGTAACTGT pLKO.1 327 CDS 100% 3.000 4.200 N F2 n/a
3 TRCN0000003633 GAACCAATCCCGTGAAAGAAT pLKO.1 1919 3UTR 100% 5.625 4.500 N F2 n/a
4 TRCN0000372153 TGTGACCGGGATGGGAAATAT pLKO_005 1803 CDS 100% 15.000 10.500 N F2 n/a
5 TRCN0000372207 GGTACTGCGACCTCAACTATT pLKO_005 874 CDS 100% 13.200 9.240 N F2 n/a
6 TRCN0000003636 CCCACATAAGCCTGAAATCAA pLKO.1 431 CDS 100% 5.625 3.938 N F2 n/a
7 TRCN0000003635 TGGATACAGAAGGTCATTGAT pLKO.1 1857 CDS 100% 5.625 3.938 N F2 n/a
8 TRCN0000003634 GAAGTGGATACAGAAGGTCAT pLKO.1 1853 CDS 100% 4.050 2.835 N F2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000506.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.