Transcript: Human NM_000523.4

Homo sapiens homeobox D13 (HOXD13), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
HOXD13 (3239)
Length:
2416
CDS:
171..1202

Additional Resources:

NCBI RefSeq record:
NM_000523.4
NBCI Gene record:
HOXD13 (3239)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000523.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274094 TCGTCCTCTTCTGCCGTTGTA pLKO_005 435 CDS 100% 4.950 6.930 N HOXD13 n/a
2 TRCN0000274030 GAGTATGCCATTAACAAATTC pLKO_005 1050 CDS 100% 13.200 10.560 N HOXD13 n/a
3 TRCN0000274095 ATCGACATGGTGTCCACTTTC pLKO_005 789 CDS 100% 10.800 7.560 N HOXD13 n/a
4 TRCN0000019835 CGAAGAGTGAAGGACAAGAAA pLKO.1 1149 CDS 100% 5.625 3.938 N HOXD13 n/a
5 TRCN0000274032 CGAAGAGTGAAGGACAAGAAA pLKO_005 1149 CDS 100% 5.625 3.938 N HOXD13 n/a
6 TRCN0000019834 CCTGACTTTGTAGTTCTGATT pLKO.1 1376 3UTR 100% 4.950 3.465 N HOXD13 n/a
7 TRCN0000274029 CCTGACTTTGTAGTTCTGATT pLKO_005 1376 3UTR 100% 4.950 3.465 N HOXD13 n/a
8 TRCN0000019836 GCAGCTTAAAGAACTGGAGAA pLKO.1 1028 CDS 100% 4.050 2.835 N HOXD13 n/a
9 TRCN0000019838 CGGCTACTACAGCTGCCGTAT pLKO.1 569 CDS 100% 1.350 0.945 N HOXD13 n/a
10 TRCN0000019837 CCAGGGCTATACGAGCCCTTA pLKO.1 749 CDS 100% 0.135 0.095 N HOXD13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000523.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.