Transcript: Human NM_000552.4

Homo sapiens von Willebrand factor (VWF), mRNA.

Source:
NCBI, updated 2019-09-12
Taxon:
Homo sapiens (human)
Gene:
VWF (7450)
Length:
8838
CDS:
256..8697

Additional Resources:

NCBI RefSeq record:
NM_000552.4
NBCI Gene record:
VWF (7450)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000552.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373946 ACATGGAAGTCAACGTTTATG pLKO_005 6365 CDS 100% 13.200 18.480 N VWF n/a
2 TRCN0000373864 GAAACGCTCCTTCTCGATTAT pLKO_005 453 CDS 100% 13.200 18.480 N VWF n/a
3 TRCN0000373863 TCACCTTCGACGGGCTCAAAT pLKO_005 2882 CDS 100% 13.200 9.240 N VWF n/a
4 TRCN0000073534 CCCTGGGTTACAAGGAAGAAA pLKO.1 8138 CDS 100% 5.625 3.938 N VWF n/a
5 TRCN0000073536 CCACAAACTGTGCTCTGGATT pLKO.1 5859 CDS 100% 4.950 3.465 N VWF n/a
6 TRCN0000073537 CCCTCCAGATAAAGTCATGTT pLKO.1 6966 CDS 100% 4.950 3.465 N VWF n/a
7 TRCN0000073533 GCAGCTGCATGGGTGCCTGCT pLKO.1 8705 3UTR 100% 0.000 0.000 N VWF n/a
8 TRCN0000096631 CAGCAGCTCATGCAACATCAT pLKO.1 873 CDS 100% 4.950 2.475 Y Creb1 n/a
9 TRCN0000301735 CAGCAGCTCATGCAACATCAT pLKO_005 873 CDS 100% 4.950 2.475 Y Creb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000552.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.