Transcript: Human NM_000618.5

Homo sapiens insulin like growth factor 1 (IGF1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-25
Taxon:
Homo sapiens (human)
Gene:
IGF1 (3479)
Length:
7277
CDS:
183..644

Additional Resources:

NCBI RefSeq record:
NM_000618.5
NBCI Gene record:
IGF1 (3479)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000618.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009842 CAAGAACTACAGGATGTAGGA pLKO.1 626 CDS 100% 2.640 2.112 N IGF1 n/a
2 TRCN0000010360 CACAAATGCATGGGTGTTGTA pLKO.1 947 3UTR 100% 4.950 3.465 N IGF1 n/a
3 TRCN0000040215 GAGTGCAGGAAACAAGAACTA pLKO.1 614 CDS 100% 4.950 3.465 N IGF1 n/a
4 TRCN0000040214 CCAATTATTTAAGTGCTGCTT pLKO.1 209 CDS 100% 2.640 1.848 N IGF1 n/a
5 TRCN0000040216 GAAGGTGAAGATGCACACCAT pLKO.1 242 CDS 100% 2.640 1.848 N IGF1 n/a
6 TRCN0000040217 GCTGAGCTGGTGGATGCTCTT pLKO.1 348 CDS 100% 1.350 0.945 N IGF1 n/a
7 TRCN0000009841 GATTTCTTGAAGGTGAAGATG pLKO.1 234 CDS 100% 4.950 2.970 N IGF1 n/a
8 TRCN0000040213 CCTCCCAAATTGCTGGGATTA pLKO.1 6185 3UTR 100% 1.080 0.540 Y IGF1 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4006 3UTR 100% 4.950 2.475 Y KAAG1 n/a
10 TRCN0000165205 GCCTCAGTTTCCTCATCTGTA pLKO.1 1910 3UTR 100% 4.950 2.475 Y YIF1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000618.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.